Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IFNG cdna clone

IFNG cDNA Clone

Gene Names
IFNG; IFG; IFI
Synonyms
IFNG; IFNG cDNA Clone; IFNG cdna clone
Ordering
For Research Use Only!
Sequence
atgaaatatacaagttatatcttggcttttcagctctgcatcgttttgggttctcttggctgttactgccaggacccatatgtaaaagaagcagaaaaccttaagaaatattttaatgcaggtcattcagatgtagcggataatggaactcttttcttaggcattttgaagaattggaaagaggagagtgacagaaaaataatgcagagccaaattgtctccttttacttcaaactttttaaaaactttaaagatgaccagagcatccaaaagagtgtggagaccatcaaggaagacatgaatgtcaagtttttcaatagcaacaaaaagaaacgagatgacttcgaaaagctgactaattattcggtaactgacttgaatgtccaacgcaaagcaatacatgaactcatccaagtgatggctgaactgtcgccagcagctaaaacagggaagcgaaaaaggagtcagatgctgtttcgaggtcgaagagcatcccagtaa
Sequence Length
501
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,348 Da
NCBI Official Full Name
Homo sapiens interferon, gamma, mRNA
NCBI Official Synonym Full Names
interferon gamma
NCBI Official Symbol
IFNG
NCBI Official Synonym Symbols
IFG; IFI
NCBI Protein Information
interferon gamma
UniProt Protein Name
Interferon gamma
Protein Family
UniProt Gene Name
IFNG
UniProt Synonym Gene Names
IFN-gamma
UniProt Entry Name
IFNG_HUMAN

NCBI Description

This gene encodes a soluble cytokine that is a member of the type II interferon class. The encoded protein is secreted by cells of both the innate and adaptive immune systems. The active protein is a homodimer that binds to the interferon gamma receptor which triggers a cellular response to viral and microbial infections. Mutations in this gene are associated with an increased susceptibility to viral, bacterial and parasitic infections and to several autoimmune diseases. [provided by RefSeq, Dec 2015]

Uniprot Description

IFNG: Produced by lymphocytes activated by specific antigens or mitogens. IFN-gamma, in addition to having antiviral activity, has important immunoregulatory functions. It is a potent activator of macrophages, it has antiproliferative effects on transformed cells and it can potentiate the antiviral and antitumor effects of the type I interferons. Homodimer. Released primarily from activated T lymphocytes. Belongs to the type II (or gamma) interferon family.

Protein type: Cytokine; Secreted, signal peptide; Membrane protein, integral; Secreted

Chromosomal Location of Human Ortholog: 12q14

Cellular Component: extracellular region; extracellular space

Molecular Function: cytokine activity

Biological Process: adaptive immune response; apoptosis; cell cycle arrest; cell motility; cell surface receptor linked signal transduction; humoral immune response; negative regulation of epithelial cell differentiation; negative regulation of interleukin-17 production; negative regulation of smooth muscle cell proliferation; negative regulation of transcription from RNA polymerase II promoter; positive regulation of autophagy; positive regulation of CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation during immune response; positive regulation of cell proliferation; positive regulation of interleukin-12 production; positive regulation of interleukin-23 production; positive regulation of killing of cells of another organism; positive regulation of membrane protein ectodomain proteolysis; positive regulation of nitric oxide biosynthetic process; positive regulation of osteoclast differentiation; positive regulation of peptidyl-serine phosphorylation of STAT protein; positive regulation of tyrosine phosphorylation of Stat1 protein; protein import into nucleus, translocation; regulation of insulin secretion; response to virus

Disease: Aplastic Anemia; Hepatitis C Virus, Susceptibility To; Human Immunodeficiency Virus Type 1, Susceptibility To; Mycobacterium Tuberculosis, Susceptibility To; Tuberous Sclerosis 2

Research Articles on IFNG

Similar Products

Product Notes

The IFNG ifng (Catalog #AAA1272040) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaatata caagttatat cttggctttt cagctctgca tcgttttggg ttctcttggc tgttactgcc aggacccata tgtaaaagaa gcagaaaacc ttaagaaata ttttaatgca ggtcattcag atgtagcgga taatggaact cttttcttag gcattttgaa gaattggaaa gaggagagtg acagaaaaat aatgcagagc caaattgtct ccttttactt caaacttttt aaaaacttta aagatgacca gagcatccaa aagagtgtgg agaccatcaa ggaagacatg aatgtcaagt ttttcaatag caacaaaaag aaacgagatg acttcgaaaa gctgactaat tattcggtaa ctgacttgaa tgtccaacgc aaagcaatac atgaactcat ccaagtgatg gctgaactgt cgccagcagc taaaacaggg aagcgaaaaa ggagtcagat gctgtttcga ggtcgaagag catcccagta a. It is sometimes possible for the material contained within the vial of "IFNG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.