Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UBB cdna clone

UBB cDNA Clone

Gene Names
UBB; HEL-S-50
Synonyms
UBB; UBB cDNA Clone; UBB cdna clone
Ordering
For Research Use Only!
Sequence
atgcagatcttcgtgaaaacccttaccggcaagaccatcacccttgaggtggagcccagtgacaccatcgaaaatgtgaaggccaagatccaggataaggaaggcattccccccgaccagcagaggctcatctttgcaggcaagcagctggaagacggccgtactctttctgactacaacatccagaaggagtcgaccctgcacctggtcctgcgtctgagaggtggtatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaagtggagcccagtgacaccatcgaaaatgtgaaggccaagatccaggataaagaaggcatccctcccgaccagcagaggctcatctttgcaggcaagcagctggaagatggccgcactctttctgactacaacatccagaaggagtcgaccctgcacctggtcctgcgtctgagaggtggtatgcagatcttcgtgaagaccctgaccggcaagaccatcactctggaggtggagcccagtgacaccatcgaaaatgtgaaggccaagatccaagataaagaaggcatcccccccgaccagcagaggctcatctttgcaggcaagcagctggaagatggccgcactctttctgactacaacatccagaaagagtcgaccctgcacctggtcctgcgcctgaggggtggctgttaa
Sequence Length
690
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,762 Da
NCBI Official Full Name
Homo sapiens ubiquitin B, mRNA
NCBI Official Synonym Full Names
ubiquitin B
NCBI Official Symbol
UBB
NCBI Official Synonym Symbols
HEL-S-50
NCBI Protein Information
polyubiquitin-B
UniProt Protein Name
Polyubiquitin-B
Protein Family
UniProt Gene Name
UBB
UniProt Entry Name
UBB_HUMAN

NCBI Description

This gene encodes ubiquitin, one of the most conserved proteins known. Ubiquitin has a major role in targeting cellular proteins for degradation by the 26S proteosome. It is also involved in the maintenance of chromatin structure, the regulation of gene expression, and the stress response. Ubiquitin is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin moiety fused to an unrelated protein. This gene consists of three direct repeats of the ubiquitin coding sequence with no spacer sequence. Consequently, the protein is expressed as a polyubiquitin precursor with a final amino acid after the last repeat. An aberrant form of this protein has been detected in patients with Alzheimer's disease and Down syndrome. Pseudogenes of this gene are located on chromosomes 1, 2, 13, and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]

Uniprot Description

UBB: Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked: Lys-6-linked may be involved in DNA repair; Lys-11-linked is involved in ERAD (endoplasmic reticulum-associated degradation) and in cell-cycle regulation; Lys-29-linked is involved in lysosomal degradation; Lys-33-linked is involved in kinase modification; Lys-48-linked is involved in protein degradation via the proteasome; Lys-63-linked is involved in endocytosis, DNA-damage responses as well as in signaling processes leading to activation of the transcription factor NF-kappa-B. Linear polymer chains formed via attachment by the initiator Met lead to cell signaling. Ubiquitin is usually conjugated to Lys residues of target proteins, however, in rare cases, conjugation to Cys or Ser residues has been observed. When polyubiquitin is free (unanchored-polyubiquitin), it also has distinct roles, such as in activation of protein kinases, and in signaling. Belongs to the ubiquitin family.

Protein type: Cell development/differentiation; Cell cycle regulation; Ubiquitin-like modifier; Apoptosis; Transcription regulation; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 17p12-p11.2

Cellular Component: cell soma; cytosol; endosome membrane; extracellular space; mitochondrion; neuron projection; nucleoplasm; nucleus; plasma membrane

Molecular Function: protein binding

Biological Process: activation of MAPK activity; activation of NF-kappaB transcription factor; anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; bypass DNA synthesis; cellular protein metabolic process; DNA damage response, detection of DNA damage; DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest; endosome transport; error-prone postreplication DNA repair; fibroblast growth factor receptor signaling pathway; G2/M transition of mitotic cell cycle; glycogen biosynthetic process; I-kappaB kinase/NF-kappaB cascade; innate immune response; JNK cascade; macroautophagy; MAPKKK cascade; mitochondrion transport along microtubule; MyD88-dependent toll-like receptor signaling pathway; MyD88-independent toll-like receptor signaling pathway; negative regulation of apoptosis; negative regulation of epidermal growth factor receptor signaling pathway; negative regulation of interferon type I production; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transforming growth factor beta receptor signaling pathway; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; neurite morphogenesis; Notch signaling pathway; nucleotide-excision repair, DNA damage recognition; nucleotide-excision repair, DNA duplex unwinding; nucleotide-excision repair, DNA gap filling; nucleotide-excision repair, DNA incision; nucleotide-excision repair, DNA incision, 5'-to lesion; nucleotide-excision repair, preincision complex assembly; positive regulation of apoptosis; positive regulation of epidermal growth factor receptor signaling pathway; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of protein ubiquitination; positive regulation of transcription from RNA polymerase II promoter; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process; regulation of interferon type I production; regulation of mitochondrial membrane potential; regulation of mRNA stability; stimulatory C-type lectin receptor signaling pathway; stress-activated MAPK cascade; T cell receptor signaling pathway; transcription-coupled nucleotide-excision repair; transforming growth factor beta receptor signaling pathway; tumor necrosis factor-mediated signaling pathway; viral infectious cycle; virus assembly; Wnt receptor signaling pathway; Wnt receptor signaling pathway, planar cell polarity pathway

Disease: Cleft Palate, Isolated

Research Articles on UBB

Similar Products

Product Notes

The UBB ubb (Catalog #AAA1272020) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagatct tcgtgaaaac ccttaccggc aagaccatca cccttgaggt ggagcccagt gacaccatcg aaaatgtgaa ggccaagatc caggataagg aaggcattcc ccccgaccag cagaggctca tctttgcagg caagcagctg gaagacggcc gtactctttc tgactacaac atccagaagg agtcgaccct gcacctggtc ctgcgtctga gaggtggtat gcagatcttc gtgaagaccc tgaccggcaa gaccatcacc ctggaagtgg agcccagtga caccatcgaa aatgtgaagg ccaagatcca ggataaagaa ggcatccctc ccgaccagca gaggctcatc tttgcaggca agcagctgga agatggccgc actctttctg actacaacat ccagaaggag tcgaccctgc acctggtcct gcgtctgaga ggtggtatgc agatcttcgt gaagaccctg accggcaaga ccatcactct ggaggtggag cccagtgaca ccatcgaaaa tgtgaaggcc aagatccaag ataaagaagg catccccccc gaccagcaga ggctcatctt tgcaggcaag cagctggaag atggccgcac tctttctgac tacaacatcc agaaagagtc gaccctgcac ctggtcctgc gcctgagggg tggctgttaa. It is sometimes possible for the material contained within the vial of "UBB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.