HIATL1 cdna clone
HIATL1 cDNA Clone
Gene Names
MFSD14B; HIATL1
Synonyms
HIATL1; HIATL1 cDNA Clone; HIATL1 cdna clone
Sequence
atgagaccggtttcctggggagctcagatttcttggaaacaagcagacccttttgcgtcgttgaagaaagttggaaaagattctactgtcttactaatctgcatcaccgtgtttctttcataccttcctgaagctggacagtattcaagtttttttctctatctcaggcaggtcataggttttggatctgttaaaattgcagcattcatagctatggtaggaattctgtctattgtggctcagacggcctttcttagcatcttgatgagatcattaggaaataagaatactgtcctccttggcttgggcttccagatgctccagttagcctggtacggttttggatcacaggcctggatgatgtgggcagcagggaccgtggctgccatgtccagcatcacgtttccggcaatcagtgccctcgtctctcggaatgcagagtcagatcagcaaggagttgcccaggggatcataactggaataagaggactatgcaatggcctggggccagcactgtatggcttcatattctacatgttccatttggaactgactgagttgggcccgaaattgaattctaacaacgttcccctgcagggagctgtcatcccaggcccgccgtttttatttggggcatgtatagtccttatgtcttttctggttgccttattcattcctgaatacagtaaagccagtggagttcaaaaacacagtaacagcagcagcggcagcctgaccaacaccccagaacggggcagtgatgaggacattgagccactactgcaagacagcagcatctgggagctctcttcatttgaggagcctgggaatcagtgcactgagctgtaa
Sequence Length
849
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
34,048 Da
NCBI Official Full Name
Homo sapiens hippocampus abundant transcript-like 1, mRNA
NCBI Official Synonym Full Names
major facilitator superfamily domain containing 14B
NCBI Official Symbol
MFSD14B
NCBI Official Synonym Symbols
HIATL1
NCBI Protein Information
hippocampus abundant transcript-like protein 1
UniProt Protein Name
Hippocampus abundant transcript-like protein 1
UniProt Gene Name
MFSD14B
UniProt Entry Name
MF14B_HUMAN
Uniprot Description
HIATL1: Belongs to the major facilitator superfamily.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 9q22.32
Cellular Component: integral to membrane
Molecular Function: transporter activity
Biological Process: transmembrane transport
Similar Products
Product Notes
The HIATL1 mfsd14b (Catalog #AAA1271956) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagaccgg tttcctgggg agctcagatt tcttggaaac aagcagaccc ttttgcgtcg ttgaagaaag ttggaaaaga ttctactgtc ttactaatct gcatcaccgt gtttctttca taccttcctg aagctggaca gtattcaagt ttttttctct atctcaggca ggtcataggt tttggatctg ttaaaattgc agcattcata gctatggtag gaattctgtc tattgtggct cagacggcct ttcttagcat cttgatgaga tcattaggaa ataagaatac tgtcctcctt ggcttgggct tccagatgct ccagttagcc tggtacggtt ttggatcaca ggcctggatg atgtgggcag cagggaccgt ggctgccatg tccagcatca cgtttccggc aatcagtgcc ctcgtctctc ggaatgcaga gtcagatcag caaggagttg cccaggggat cataactgga ataagaggac tatgcaatgg cctggggcca gcactgtatg gcttcatatt ctacatgttc catttggaac tgactgagtt gggcccgaaa ttgaattcta acaacgttcc cctgcaggga gctgtcatcc caggcccgcc gtttttattt ggggcatgta tagtccttat gtcttttctg gttgccttat tcattcctga atacagtaaa gccagtggag ttcaaaaaca cagtaacagc agcagcggca gcctgaccaa caccccagaa cggggcagtg atgaggacat tgagccacta ctgcaagaca gcagcatctg ggagctctct tcatttgagg agcctgggaa tcagtgcact gagctgtaa. It is sometimes possible for the material contained within the vial of "HIATL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
