Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MYOC cdna clone

MYOC cDNA Clone

Gene Names
MYOC; GPOA; JOAG; TIGR; GLC1A; JOAG1
Synonyms
MYOC; MYOC cDNA Clone; MYOC cdna clone
Ordering
For Research Use Only!
Sequence
atgaggttcttctgtgcacgttgctgcagctttgggcctgagatgccagctgtccagctgctgcttctggcctgcctggtgtgggatgtgggggccaggacagctcagctcaggaaggccaatgaccagagtggccgatgccagtataccttcagtgtggccagtcccaatgaatccagctgcccagagcagagccaggccatgtcagtcatccataacttacagagagacagcagcacccaacgcttagacctggaggccaccaaagctcgactcagctccctggagagcctcctccaccaattgaccttggaccaggctgccaggccccaggagacccaggaggggctgcagagggagctgggcaccctgaggcgggagcgggaccagctggaaacccaaaccagagagttggagactgcctacagcaacctcctccgagacaagtcagttctggaggaagagaagaagcgactaaggcaagaaaatgagaatctggccaggaggttggaaagcagcagccaggaggtagcaaggctgagaaggggccagtgtccccagacccgagacactgctcgggctgtgccaccaggctccagagaagtttctacgtggaatttggacactttggccttccaggaactgaagtccgagctaactgaagttcctgcttcccgaattttgaaggagagcccatctggctatctcaggagtggagagggagacaccggatgtggagaactagtttgggtaggagagcctctcacgctgagaacagcagaaacaattactggcaagtatggtgtgtggatgcgagaccccaagcccacctacccctacacccaggagaccacgtggagaatcgacacagttggcacggatgtccgccaggtttttgagtatgacctcatcagccagtttatgcagggctacccttctaaggttcacatactgcctaggccactggaaagcacgggtgctgtggtgtactcggggagcctctatttccagggcgctgagtccagaactgtcataagatatgagctgaataccgagacagtgaaggctgagaaggaaatccctggagctggctaccacggacagttcccgtattcttggggtggctacacggacattgacttggctgtggatgaagcaggcctctgggtcatttacagcaccgatgaggccaaaggtgccattgtcctctccaaactgaacccagagaatctggaactcgaacaaacctgggagacaaacatccgtaagcagtcagtcgccaatgccttcatcatctgtggcaccttgtacaccgtcagcagctacacctcagcagatgctaccgtcaactttgcttatgacacaggcacaggtatcagcaagaccctgaccatcccattcaagaaccgctataagtacagcagcatgattgactacaaccccctggagaagaagctctttgcctgggacaacttgaacatggtcacttatgacatcaagctctccaagatgtga
Sequence Length
1515
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,972 Da
NCBI Official Full Name
Homo sapiens myocilin, trabecular meshwork inducible glucocorticoid response, mRNA
NCBI Official Synonym Full Names
myocilin
NCBI Official Symbol
MYOC
NCBI Official Synonym Symbols
GPOA; JOAG; TIGR; GLC1A; JOAG1
NCBI Protein Information
myocilin
UniProt Protein Name
Myocilin
Protein Family
UniProt Gene Name
MYOC
UniProt Entry Name
MYOC_HUMAN

NCBI Description

MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible response protein (TIGR). The trabecular meshwork is a specialized eye tissue essential in regulating intraocular pressure, and mutations in MYOC have been identified as the cause of hereditary juvenile-onset open-angle glaucoma. [provided by RefSeq, Jul 2008]

Uniprot Description

MYOC: May participate in the obstruction of fluid outflow in the trabecular meshwork. Defects in MYOC are the cause of primary open angle glaucoma type 1A (GLC1A). Primary open angle glaucoma (POAG) is characterized by a specific pattern of optic nerve and visual field defects. The angle of the anterior chamber of the eye is open, and usually the intraocular pressure is increased. The disease is asymptomatic until the late stages, by which time significant and irreversible optic nerve damage has already taken place. Defects in MYOC are a cause of primary congenital glaucoma type 3A (GLC3A). An autosomal recessive form of primary congenital glaucoma (PCG). PCG is characterized by marked increase of intraocular pressure at birth or early choldhood, large ocular globes (buphthalmos) and corneal edema. It results from developmental defects of the trabecular meshwork and anterior chamber angle of the eye that prevent adequate drainage of aqueous humor. MYOC variations may contribute to GLC3A via digenic inheritance with CYP1B1 and/or another locus associated with the disease.

Protein type: Endoplasmic reticulum; Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 1q23-q24

Cellular Component: cytoplasmic vesicle; endoplasmic reticulum; extracellular matrix; extracellular space; Golgi apparatus; mitochondrial inner membrane; mitochondrial intermembrane space; mitochondrial outer membrane

Molecular Function: fibronectin binding; frizzled binding; myosin light chain binding; protein binding

Biological Process: clustering of voltage-gated sodium channels; myelination in the peripheral nervous system; negative regulation of cell-matrix adhesion; negative regulation of Rho protein signal transduction; negative regulation of stress fiber formation; neurite development; osteoblast differentiation; positive regulation of cell migration; positive regulation of focal adhesion formation; positive regulation of mitochondrial depolarization; positive regulation of phosphoinositide 3-kinase cascade; positive regulation of protein kinase B signaling cascade; positive regulation of stress fiber formation; regulation of MAPKKK cascade; skeletal muscle hypertrophy

Disease: Glaucoma 1, Open Angle, A

Research Articles on MYOC

Similar Products

Product Notes

The MYOC myoc (Catalog #AAA1271954) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggttct tctgtgcacg ttgctgcagc tttgggcctg agatgccagc tgtccagctg ctgcttctgg cctgcctggt gtgggatgtg ggggccagga cagctcagct caggaaggcc aatgaccaga gtggccgatg ccagtatacc ttcagtgtgg ccagtcccaa tgaatccagc tgcccagagc agagccaggc catgtcagtc atccataact tacagagaga cagcagcacc caacgcttag acctggaggc caccaaagct cgactcagct ccctggagag cctcctccac caattgacct tggaccaggc tgccaggccc caggagaccc aggaggggct gcagagggag ctgggcaccc tgaggcggga gcgggaccag ctggaaaccc aaaccagaga gttggagact gcctacagca acctcctccg agacaagtca gttctggagg aagagaagaa gcgactaagg caagaaaatg agaatctggc caggaggttg gaaagcagca gccaggaggt agcaaggctg agaaggggcc agtgtcccca gacccgagac actgctcggg ctgtgccacc aggctccaga gaagtttcta cgtggaattt ggacactttg gccttccagg aactgaagtc cgagctaact gaagttcctg cttcccgaat tttgaaggag agcccatctg gctatctcag gagtggagag ggagacaccg gatgtggaga actagtttgg gtaggagagc ctctcacgct gagaacagca gaaacaatta ctggcaagta tggtgtgtgg atgcgagacc ccaagcccac ctacccctac acccaggaga ccacgtggag aatcgacaca gttggcacgg atgtccgcca ggtttttgag tatgacctca tcagccagtt tatgcagggc tacccttcta aggttcacat actgcctagg ccactggaaa gcacgggtgc tgtggtgtac tcggggagcc tctatttcca gggcgctgag tccagaactg tcataagata tgagctgaat accgagacag tgaaggctga gaaggaaatc cctggagctg gctaccacgg acagttcccg tattcttggg gtggctacac ggacattgac ttggctgtgg atgaagcagg cctctgggtc atttacagca ccgatgaggc caaaggtgcc attgtcctct ccaaactgaa cccagagaat ctggaactcg aacaaacctg ggagacaaac atccgtaagc agtcagtcgc caatgccttc atcatctgtg gcaccttgta caccgtcagc agctacacct cagcagatgc taccgtcaac tttgcttatg acacaggcac aggtatcagc aagaccctga ccatcccatt caagaaccgc tataagtaca gcagcatgat tgactacaac cccctggaga agaagctctt tgcctgggac aacttgaaca tggtcactta tgacatcaag ctctccaaga tgtga. It is sometimes possible for the material contained within the vial of "MYOC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.