PSG5 cdna clone
PSG5 cDNA Clone
Gene Names
PSG5; PSG; FL-NCA-3
Synonyms
PSG5; PSG5 cDNA Clone; PSG5 cdna clone
Sequence
atggggcccctctcagcccctccctgcacacagcacatcacctggaagggggtcctgctcacagcatcacttttaaacttctggaacctgcctatcactgctcaagtcacgattgaagccctgccacccaaagtttccgaggggaaggatgttcttctacttgtccacaatttgcctcagaatcttgctggctacatctggtacaaaggacaactgatggacctctaccattacattacatcatatgtagtagacggtcaaataaatatatatgggcctgcatacactggacgagaaacagtatattccaatgcatccctgctgatccagaatgtcacccgggaagacgcaggatcctataccttacacatcataaagcgaggtgataggactagaggagtaactggatatttcaccttcaacttatacctgaagctgcccaagccctacatcaccatcaacaactcaaaacccagggagaataaggatgtcttagccttcacctgtgaacctaagagtgagaactacacctacatttggtggctaaatggtcagagcctcccggtcagtcccagggtaaagcaacccattgaaaacaggatcctcattctacccagtgtcacgagaaatgaaacaggaccctatgaatgtgaaatacgggaccgagatggtggcatgcacagtgacccagtcaccctgaatgtcctctatggtccagacctccccagcatttacccttcattcacctattaccgttcaggagaaaacctctacttgtcctgcttcgcggaatctaacccaccggcagagtatttttggacaattaatgggaagtttcagcaatcaggacaaaagctctctatcccccaaattactacaaagcatagagggctctatacttgctctgttcgtaactcagccactggcaaggaaagctccaaatccatgacagtcgaagtctctgctccttcaggaataggacgtcttcctctccttaatccaatatag
Sequence Length
1008
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
37,713 Da
NCBI Official Full Name
Homo sapiens pregnancy specific beta-1-glycoprotein 5, mRNA
NCBI Official Synonym Full Names
pregnancy specific beta-1-glycoprotein 5
NCBI Official Symbol
PSG5
NCBI Official Synonym Symbols
PSG; FL-NCA-3
NCBI Protein Information
pregnancy-specific beta-1-glycoprotein 5
UniProt Protein Name
Pregnancy-specific beta-1-glycoprotein 5
Protein Family
UniProt Gene Name
PSG5
UniProt Synonym Gene Names
PS-beta-G-5; PSBG-5; Pregnancy-specific glycoprotein 5; FL-NCA-3
UniProt Entry Name
PSG5_HUMAN
NCBI Description
The human pregnancy-specific glycoproteins (PSGs) are a group of molecules that are mainly produced by the placental syncytiotrophoblasts during pregnancy. PSGs comprise a subgroup of the carcinoembryonic antigen (CEA) family, which belongs to the immunoglobulin superfamily. For additional general information about the PSG gene family, see PSG1 (MIM 176390).[supplied by OMIM, Oct 2009]
Uniprot Description
PSG5: Belongs to the immunoglobulin superfamily. CEA family
Protein type: Secreted, signal peptide; Secreted
Chromosomal Location of Human Ortholog: 19q13.2
Molecular Function: protein binding
Biological Process: female pregnancy
Research Articles on PSG5
Similar Products
Product Notes
The PSG5 psg5 (Catalog #AAA1271907) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggcccc tctcagcccc tccctgcaca cagcacatca cctggaaggg ggtcctgctc acagcatcac ttttaaactt ctggaacctg cctatcactg ctcaagtcac gattgaagcc ctgccaccca aagtttccga ggggaaggat gttcttctac ttgtccacaa tttgcctcag aatcttgctg gctacatctg gtacaaagga caactgatgg acctctacca ttacattaca tcatatgtag tagacggtca aataaatata tatgggcctg catacactgg acgagaaaca gtatattcca atgcatccct gctgatccag aatgtcaccc gggaagacgc aggatcctat accttacaca tcataaagcg aggtgatagg actagaggag taactggata tttcaccttc aacttatacc tgaagctgcc caagccctac atcaccatca acaactcaaa acccagggag aataaggatg tcttagcctt cacctgtgaa cctaagagtg agaactacac ctacatttgg tggctaaatg gtcagagcct cccggtcagt cccagggtaa agcaacccat tgaaaacagg atcctcattc tacccagtgt cacgagaaat gaaacaggac cctatgaatg tgaaatacgg gaccgagatg gtggcatgca cagtgaccca gtcaccctga atgtcctcta tggtccagac ctccccagca tttacccttc attcacctat taccgttcag gagaaaacct ctacttgtcc tgcttcgcgg aatctaaccc accggcagag tatttttgga caattaatgg gaagtttcag caatcaggac aaaagctctc tatcccccaa attactacaa agcatagagg gctctatact tgctctgttc gtaactcagc cactggcaag gaaagctcca aatccatgac agtcgaagtc tctgctcctt caggaatagg acgtcttcct ctccttaatc caatatag. It is sometimes possible for the material contained within the vial of "PSG5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
