Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL1B cdna clone

IL1B cDNA Clone

Gene Names
IL1B; IL-1; IL1F2; IL1-BETA
Synonyms
IL1B; IL1B cDNA Clone; IL1B cdna clone
Ordering
For Research Use Only!
Sequence
atggcagaagtacctgagctcgccagtgaaatgatggcttattacagtggcaatgaggatgacttgttctttgaagctgatggccctaaacagatgaagtgctccttccaggacctggacctctgccctctggatggcggcatccagctacgaatctccgaccaccactacagcaagggcttcaggcaggccgcgtcagttgttgtggccatggacaagctgaggaagatgctggttccctgcccacagaccttccaggagaatgacctgagcaccttctttcccttcatctttgaagaagaacctatcttcttcgacacatgggataacgaggcttatgtgcacgatgcacctgtacgatcactgaactgcacgctccgggactcacagcaaaaaagcttggtgatgtctggtccatatgaactgaaagctctccacctccagggacaggatatggagcaacaagtggtgttctccatgtcctttgtacaaggagaagaaagtaatgacaaaatacctgtggccttgggcctcaaggaaaagaatctgtacctgtcctgcgtgttgaaagatgataagcccactctacagctggagagtgtagatcccaaaaattacccaaagaagaagatggaaaagcgatttgtcttcaacaagatagaaatcaataacaagctggaatttgagtctgcccagttccccaactggtacatcagcacctctcaagcagaaaacatgcccgtcttcctgggagggaccaaaggcggccaggatataactgacttcaccatgcaatttgtgtcttcctaa
Sequence Length
810
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,748 Da
NCBI Official Full Name
Homo sapiens interleukin 1, beta, mRNA
NCBI Official Synonym Full Names
interleukin 1 beta
NCBI Official Symbol
IL1B
NCBI Official Synonym Symbols
IL-1; IL1F2; IL1-BETA
NCBI Protein Information
interleukin-1 beta
UniProt Protein Name
Interleukin-1 beta
Protein Family
UniProt Gene Name
IL1B
UniProt Synonym Gene Names
IL1F2; IL-1 beta
UniProt Entry Name
IL1B_HUMAN

NCBI Description

The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is produced by activated macrophages as a proprotein, which is proteolytically processed to its active form by caspase 1 (CASP1/ICE). This cytokine is an important mediator of the inflammatory response, and is involved in a variety of cellular activities, including cell proliferation, differentiation, and apoptosis. The induction of cyclooxygenase-2 (PTGS2/COX2) by this cytokine in the central nervous system (CNS) is found to contribute to inflammatory pain hypersensitivity. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. [provided by RefSeq, Jul 2008]

Uniprot Description

IL1B: Produced by activated macrophages, IL-1 stimulates thymocyte proliferation by inducing IL-2 release, B-cell maturation and proliferation, and fibroblast growth factor activity. IL-1 proteins are involved in the inflammatory response, being identified as endogenous pyrogens, and are reported to stimulate the release of prostaglandin and collagenase from synovial cells. Monomer. Belongs to the IL-1 family.

Protein type: Cytokine

Chromosomal Location of Human Ortholog: 2q14

Cellular Component: cytosol; extracellular region; extracellular space

Molecular Function: cytokine activity; interleukin-1 receptor binding; protein domain specific binding

Biological Process: activation of MAPK activity; activation of NF-kappaB transcription factor; apoptosis; cell-cell signaling; cytokine and chemokine mediated signaling pathway; embryo implantation; hyaluronan biosynthetic process; inflammatory response; lipopolysaccharide-mediated signaling pathway; MAPKKK cascade; negative regulation of cell proliferation; negative regulation of insulin receptor signaling pathway; negative regulation of lipid catabolic process; negative regulation of lipid metabolic process; negative regulation of MAP kinase activity; positive regulation of angiogenesis; positive regulation of fever; positive regulation of granulocyte macrophage colony-stimulating factor production; positive regulation of heterotypic cell-cell adhesion; positive regulation of interferon-gamma production; positive regulation of interleukin-2 biosynthetic process; positive regulation of interleukin-6 production; positive regulation of interleukin-8 production; positive regulation of JNK cascade; positive regulation of lipid catabolic process; positive regulation of membrane protein ectodomain proteolysis; positive regulation of mitosis; positive regulation of NF-kappaB import into nucleus; positive regulation of nitric oxide biosynthetic process; positive regulation of phagocytosis; positive regulation of prostaglandin secretion; positive regulation of protein amino acid phosphorylation; positive regulation of T cell mediated immunity; positive regulation of T cell proliferation; positive regulation of transcription factor activity; positive regulation of transcription, DNA-dependent; positive regulation of vascular endothelial growth factor receptor signaling pathway; protein kinase B signaling cascade; regulation of I-kappaB kinase/NF-kappaB cascade; regulation of insulin secretion; regulation of nitric-oxide synthase activity; sequestering of triacylglycerol; signal transduction

Disease: Gastric Cancer, Hereditary Diffuse

Research Articles on IL1B

Similar Products

Product Notes

The IL1B il1b (Catalog #AAA1271847) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagaag tacctgagct cgccagtgaa atgatggctt attacagtgg caatgaggat gacttgttct ttgaagctga tggccctaaa cagatgaagt gctccttcca ggacctggac ctctgccctc tggatggcgg catccagcta cgaatctccg accaccacta cagcaagggc ttcaggcagg ccgcgtcagt tgttgtggcc atggacaagc tgaggaagat gctggttccc tgcccacaga ccttccagga gaatgacctg agcaccttct ttcccttcat ctttgaagaa gaacctatct tcttcgacac atgggataac gaggcttatg tgcacgatgc acctgtacga tcactgaact gcacgctccg ggactcacag caaaaaagct tggtgatgtc tggtccatat gaactgaaag ctctccacct ccagggacag gatatggagc aacaagtggt gttctccatg tcctttgtac aaggagaaga aagtaatgac aaaatacctg tggccttggg cctcaaggaa aagaatctgt acctgtcctg cgtgttgaaa gatgataagc ccactctaca gctggagagt gtagatccca aaaattaccc aaagaagaag atggaaaagc gatttgtctt caacaagata gaaatcaata acaagctgga atttgagtct gcccagttcc ccaactggta catcagcacc tctcaagcag aaaacatgcc cgtcttcctg ggagggacca aaggcggcca ggatataact gacttcacca tgcaatttgt gtcttcctaa. It is sometimes possible for the material contained within the vial of "IL1B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.