Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RBM14 cdna clone

RBM14 cDNA Clone

Gene Names
RBM14; SIP; COAA; PSP2; SYTIP1; TMEM137
Synonyms
RBM14; RBM14 cDNA Clone; RBM14 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagatattcgtgggcaacgtcgacggggcggatacgactccggaggagctggcagccctctttgcgccctacggcacggtcatgagctgcgccgtcatgaaacagttcgccttcgtgcacatgcgcgagaacgcgggcgcgctgcgcgccatcgaagccctgcacggccacgagctgcggccggggcgcgcgctcgtggtggagatgtcgcgcccaaggcctcttaatacttggaagattttcgtgggcaatgtgtcggctgcatgcacgagccaggaactgcgcagcctcttcgagcgccgcggacgcgtcatcgagtgtgacgtggtgaaagactacgcgtttgttcacatggagaaggaagcagatgccaaagccgcaatcgcgcagctcaacggcaaagaagtgaagggcaagcgcatcaacgtggaactctccaccaagggtcagaagaaggggcctggcctggctgtccagtctggggacaagaccaagaaaccaggggctggggatacggccttccctggaactggtggcttctctgccaccttcgactaccagcaggcttttggcaacagcactggtggctttgatgggcaagcccgtcagcccacaccacccttctttggtcgcgaccgcagccctctgcgccgttcacctccccgagcctcttatgtggctcctctgacggcccagccagctacctaccgggcccagccgtccgtgtcactgggagctgcctacagggcccagccttctgcctctttgggtgttggctatcggactcagcccatgacagcccaggcagcctcttaccgcgctcagccctctgtctcccttggggcaccatacaggggccagctggctagtcctagctcccagtctgctgcagcttcttcactcggcccatatggtggagcccagccctcagcctcggccctttcctcctatgggggtcaggcagctgcagcttcttcgctcaactcctatggggctcagggttcctcccttgcctcctatggtaaccagccatcctcttacggcgcccaggctgcctcttcctatggggttcgtgcagctgcttcttcctacaacacccagggagcagcttcctccttaggctcctacggggctcaggcagcctcctatggggcccagtctgcagcctcctcactagcttatggagcccaggcagcttcatataatgcccagccctcggcctcttacaatgcccagtctgccccatatgctgcacagcaggctgcttcctactcttcccaacctgctgcctatgtggcacagccagccacagctgctgcctatgccagccagccagcagcctacgccgcacaagccactaccccaatggctggctcctatggggcccagccggttgtgcagacccagctgaatagttacggggcccaagcatcaatgggcctttcaggctcctatggggctcagtcggctgctgcggccactggctcctatggtgccgcagcagcctacggggcccaaccttctgccaccctggcagctccttaccgcactcagtcatcagcctcattggctgcttcctatgctgcccagcagcatccccaggctgctgcctcctaccgcggccagccaggcaatgcctacgatggggcaggtcagccgtctgcagcctacctgtccatgtcccagggggccgttgccaacgccaacagcaccccgccgccctatgagcgtacccgcctctccccaccccgggccagctacgacgatccctacaaaaaggctgtcgccatgtcgaaaaggtatggttccgaccggcgtttagccgagctctctgattaccgccgtttatcagagtcgcagctttcgttccgccgctcgccgacaaagtcctcgctggattaccgtcgcctgcccgatgcccattccgattacgcacgctattcgggctcctataatgattacctgcgggcggctcagatgcactctggctaccagcgccgcatgtag
Sequence Length
2010
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,035 Da
NCBI Official Full Name
Homo sapiens RNA binding motif protein 14, mRNA
NCBI Official Synonym Full Names
RNA binding motif protein 14
NCBI Official Symbol
RBM14
NCBI Official Synonym Symbols
SIP; COAA; PSP2; SYTIP1; TMEM137
NCBI Protein Information
RNA-binding protein 14
UniProt Protein Name
RNA-binding protein 14
Protein Family
UniProt Gene Name
RBM14
UniProt Synonym Gene Names
SIP; PSP2; SYT-interacting protein
UniProt Entry Name
RBM14_HUMAN

NCBI Description

This gene encodes a ribonucleoprotein that functions as a general nuclear coactivator, and an RNA splicing modulator. This protein contains two RNA recognition motifs (RRM) at the N-terminus, and multiple hexapeptide repeat domain at the C-terminus that interacts with thyroid hormone receptor-binding protein (TRBP), and is required for transcription activation. Alternatively spliced transcript variants encoding different isoforms (with opposing effects on transcription) have been described for this gene. [provided by RefSeq, Oct 2011]

Uniprot Description

RBM14: an RNA binding protein and transcriptional regulator. Expressed in all tissues tested, including brain, heart, skeletal muscle, colon, thymus, spleen, kidney, liver, small intestine, placenta, lung and peripheral blood lymphocytes. Two alternatively spliced isoforms have been observed. Isoform 1 may function as a nuclear receptor coactivator, enhancing transcription through other coactivators such as NCOA6 and CITED1. Isoform 2, functions as a transcriptional repressor, modulating transcriptional activities of coactivators including isoform 1, NCOA6 and CITED1.

Protein type: RNA-binding; Nucleolus; Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 11q13.2

Cellular Component: cytoplasm; nucleoplasm; nucleus; ribonucleoprotein complex; transcription factor complex

Molecular Function: ligand-dependent nuclear receptor transcription coactivator activity; protein binding

Biological Process: histone deacetylation; negative regulation of centriole replication; positive regulation of transcription from RNA polymerase II promoter; response to hormone stimulus

Research Articles on RBM14

Similar Products

Product Notes

The RBM14 rbm14 (Catalog #AAA1271781) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagatat tcgtgggcaa cgtcgacggg gcggatacga ctccggagga gctggcagcc ctctttgcgc cctacggcac ggtcatgagc tgcgccgtca tgaaacagtt cgccttcgtg cacatgcgcg agaacgcggg cgcgctgcgc gccatcgaag ccctgcacgg ccacgagctg cggccggggc gcgcgctcgt ggtggagatg tcgcgcccaa ggcctcttaa tacttggaag attttcgtgg gcaatgtgtc ggctgcatgc acgagccagg aactgcgcag cctcttcgag cgccgcggac gcgtcatcga gtgtgacgtg gtgaaagact acgcgtttgt tcacatggag aaggaagcag atgccaaagc cgcaatcgcg cagctcaacg gcaaagaagt gaagggcaag cgcatcaacg tggaactctc caccaagggt cagaagaagg ggcctggcct ggctgtccag tctggggaca agaccaagaa accaggggct ggggatacgg ccttccctgg aactggtggc ttctctgcca ccttcgacta ccagcaggct tttggcaaca gcactggtgg ctttgatggg caagcccgtc agcccacacc acccttcttt ggtcgcgacc gcagccctct gcgccgttca cctccccgag cctcttatgt ggctcctctg acggcccagc cagctaccta ccgggcccag ccgtccgtgt cactgggagc tgcctacagg gcccagcctt ctgcctcttt gggtgttggc tatcggactc agcccatgac agcccaggca gcctcttacc gcgctcagcc ctctgtctcc cttggggcac catacagggg ccagctggct agtcctagct cccagtctgc tgcagcttct tcactcggcc catatggtgg agcccagccc tcagcctcgg ccctttcctc ctatgggggt caggcagctg cagcttcttc gctcaactcc tatggggctc agggttcctc ccttgcctcc tatggtaacc agccatcctc ttacggcgcc caggctgcct cttcctatgg ggttcgtgca gctgcttctt cctacaacac ccagggagca gcttcctcct taggctccta cggggctcag gcagcctcct atggggccca gtctgcagcc tcctcactag cttatggagc ccaggcagct tcatataatg cccagccctc ggcctcttac aatgcccagt ctgccccata tgctgcacag caggctgctt cctactcttc ccaacctgct gcctatgtgg cacagccagc cacagctgct gcctatgcca gccagccagc agcctacgcc gcacaagcca ctaccccaat ggctggctcc tatggggccc agccggttgt gcagacccag ctgaatagtt acggggccca agcatcaatg ggcctttcag gctcctatgg ggctcagtcg gctgctgcgg ccactggctc ctatggtgcc gcagcagcct acggggccca accttctgcc accctggcag ctccttaccg cactcagtca tcagcctcat tggctgcttc ctatgctgcc cagcagcatc cccaggctgc tgcctcctac cgcggccagc caggcaatgc ctacgatggg gcaggtcagc cgtctgcagc ctacctgtcc atgtcccagg gggccgttgc caacgccaac agcaccccgc cgccctatga gcgtacccgc ctctccccac cccgggccag ctacgacgat ccctacaaaa aggctgtcgc catgtcgaaa aggtatggtt ccgaccggcg tttagccgag ctctctgatt accgccgttt atcagagtcg cagctttcgt tccgccgctc gccgacaaag tcctcgctgg attaccgtcg cctgcccgat gcccattccg attacgcacg ctattcgggc tcctataatg attacctgcg ggcggctcag atgcactctg gctaccagcg ccgcatgtag. It is sometimes possible for the material contained within the vial of "RBM14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.