Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GUCY1A3 cdna clone

GUCY1A3 cDNA Clone

Gene Names
GUCY1A3; GUCA3; MYMY6; GC-SA3; GUC1A3; GUCSA3; GUCY1A1
Synonyms
GUCY1A3; GUCY1A3 cDNA Clone; GUCY1A3 cdna clone
Ordering
For Research Use Only!
Sequence
atgttctgcacgaagctcaaggatctcaagatcacaggagagtgtcctttctccttactggcaccaggtcaagttcctaacgagtcttcagaggaggcagcaggaagctcagagagctgcaaagcaaccgtgcccatctgtcaagacattcctgagaagaacatacaagaaagtcttcctcaaagaaaaaccagtcggagccgagtctatcttcacactttggcagagagtatttgcaaactgattttcccagagtttgaacggctgaatgttgcacttcagagaacattggcaaagcacaaaataaaagaaagcaggaaatctttggaaagagaagactttgaaaaaacaattgcagagcaagcagttgcagcaggtggagaccattggcgatgcctattgtgtagctgggggattacacaaagagagtga
Sequence Length
432
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,106 Da
NCBI Official Full Name
Homo sapiens guanylate cyclase 1, soluble, alpha 3, mRNA
NCBI Official Synonym Full Names
guanylate cyclase 1 soluble subunit alpha
NCBI Official Symbol
GUCY1A3
NCBI Official Synonym Symbols
GUCA3; MYMY6; GC-SA3; GUC1A3; GUCSA3; GUCY1A1
NCBI Protein Information
guanylate cyclase soluble subunit alpha-3
UniProt Protein Name
GUCY1A3 protein
Protein Family
UniProt Gene Name
GUCY1A3
UniProt Entry Name
Q6PJR4_HUMAN

NCBI Description

Soluble guanylate cyclases are heterodimeric proteins that catalyze the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. The protein encoded by this gene is an alpha subunit of this complex and it interacts with a beta subunit to form the guanylate cyclase enzyme, which is activated by nitric oxide. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]

Research Articles on GUCY1A3

Similar Products

Product Notes

The GUCY1A3 gucy1a3 (Catalog #AAA1271774) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttctgca cgaagctcaa ggatctcaag atcacaggag agtgtccttt ctccttactg gcaccaggtc aagttcctaa cgagtcttca gaggaggcag caggaagctc agagagctgc aaagcaaccg tgcccatctg tcaagacatt cctgagaaga acatacaaga aagtcttcct caaagaaaaa ccagtcggag ccgagtctat cttcacactt tggcagagag tatttgcaaa ctgattttcc cagagtttga acggctgaat gttgcacttc agagaacatt ggcaaagcac aaaataaaag aaagcaggaa atctttggaa agagaagact ttgaaaaaac aattgcagag caagcagttg cagcaggtgg agaccattgg cgatgcctat tgtgtagctg ggggattaca caaagagagt ga. It is sometimes possible for the material contained within the vial of "GUCY1A3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.