Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GOLGA7 cdna clone

GOLGA7 cDNA Clone

Gene Names
GOLGA7; GCP16; GOLGA7A; HSPC041; GOLGA3AP1
Synonyms
GOLGA7; GOLGA7 cDNA Clone; GOLGA7 cdna clone
Ordering
For Research Use Only!
Sequence
atgaggccgcagcaggcgccggtgtccggaaaggtgttcattcagcgagactacagcagtggcacacgctgccagttccagaccaagttccctgcggagctggagaaccggattgataggcagcagtttgaagaaacagttcgaactctaaataacctttatgcagaagcagagaagctcggcggccagtcatatctcgaaggttgtttggcttgtttaacagcatataccatcttcctatgcatggaaactcattatgagaaggttctgaagaaagtctccaaatacattcaagagcagaatgagaagatctatgctccacaaggcctcctcctgacagaccctattgagcgaggactgcgagtttttagattgaaattaccatttatgaagacagaggcatga
Sequence Length
405
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,578 Da
NCBI Official Full Name
Homo sapiens golgi autoantigen, golgin subfamily a, 7, mRNA
NCBI Official Synonym Full Names
golgin A7
NCBI Official Symbol
GOLGA7
NCBI Official Synonym Symbols
GCP16; GOLGA7A; HSPC041; GOLGA3AP1
NCBI Protein Information
golgin subfamily A member 7
UniProt Protein Name
Golgin subfamily A member 7
Protein Family
UniProt Gene Name
GOLGA7
UniProt Synonym Gene Names
GCP16
UniProt Entry Name
GOGA7_HUMAN

Uniprot Description

GOLGA7: May be involved in protein transport from Golgi to cell surface. The ZDHHC9-GOLGA7 complex is a palmitoyltransferase specific for HRAS and NRAS. Belongs to the ERF4 family.

Protein type: Transferase

Chromosomal Location of Human Ortholog: 8p11.21

Cellular Component: Golgi stack; intrinsic to Golgi membrane

Molecular Function: protein binding; protein-cysteine S-palmitoleyltransferase activity

Biological Process: Golgi to plasma membrane protein transport; peptidyl-S-palmitoyl-L-cysteine biosynthetic process from peptidyl-cysteine; protein stabilization; protein targeting to membrane

Research Articles on GOLGA7

Similar Products

Product Notes

The GOLGA7 golga7 (Catalog #AAA1271758) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggccgc agcaggcgcc ggtgtccgga aaggtgttca ttcagcgaga ctacagcagt ggcacacgct gccagttcca gaccaagttc cctgcggagc tggagaaccg gattgatagg cagcagtttg aagaaacagt tcgaactcta aataaccttt atgcagaagc agagaagctc ggcggccagt catatctcga aggttgtttg gcttgtttaa cagcatatac catcttccta tgcatggaaa ctcattatga gaaggttctg aagaaagtct ccaaatacat tcaagagcag aatgagaaga tctatgctcc acaaggcctc ctcctgacag accctattga gcgaggactg cgagttttta gattgaaatt accatttatg aagacagagg catga. It is sometimes possible for the material contained within the vial of "GOLGA7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.