Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UBE2A cdna clone

UBE2A cDNA Clone

Gene Names
UBE2A; UBC2; HHR6A; MRXSN; RAD6A; MRXS30
Synonyms
UBE2A; UBE2A cDNA Clone; UBE2A cdna clone
Ordering
For Research Use Only!
Sequence
atgtccaccccggctcggcggcgcctcatgcgggacttcaagaggttgcaggaggatcctccagccggagtcagcggggctccgtccgagaacaacataatggtgtggaacgcggtcattttcgggcctgaagggaccccgtttgaggatggaacatttaaacttacaatagaattcactgaagaatatccaaataaaccacctacagttagatttgtctctaagatgttccatccaaatgtctatgcagatggtagtatatgtctggacatacttcagaaccgttggagtccaacctatgatgtgtcttccattctaacatccatacagtctctgttggatgaacccaatcccaatagtccagcaaacagccaggctgctcagctgtaccaggagaacaaacgggaatatgaaaagcgtgtttctgcaatagtagaacaaagctggcgtgattgttga
Sequence Length
459
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
8,833 Da
NCBI Official Full Name
Homo sapiens ubiquitin-conjugating enzyme E2A (RAD6 homolog), mRNA
NCBI Official Synonym Full Names
ubiquitin conjugating enzyme E2 A
NCBI Official Symbol
UBE2A
NCBI Official Synonym Symbols
UBC2; HHR6A; MRXSN; RAD6A; MRXS30
NCBI Protein Information
ubiquitin-conjugating enzyme E2 A
UniProt Protein Name
Ubiquitin-conjugating enzyme E2 A
UniProt Gene Name
UBE2A
UniProt Synonym Gene Names
RAD6A; HR6A; hHR6A
UniProt Entry Name
UBE2A_HUMAN

NCBI Description

The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, ubiquitin-conjugating enzymes, and ubiquitin-protein ligases. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is required for post-replicative DNA damage repair, and may play a role in transcriptional regulation. Mutations in this gene are associated with mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]

Uniprot Description

UBE2A: a ubiquitin-protein ligase, a member of the ubiquitin-conjugating enzyme family. Homologous to the yeast DNA repair gene RAD6. Interacts with RAD18. Required for postreplication repair of UV-damaged DNA.

Protein type: Ligase; Ubiquitin ligase; EC 6.3.2.19; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: Xq24

Cellular Component: chromatin; cytoplasm; cytosol; nuclear chromatin

Molecular Function: protein binding; ubiquitin binding; ubiquitin protein ligase binding; ubiquitin-protein ligase activity

Biological Process: DNA repair; histone H2A ubiquitination; positive regulation of cell proliferation; proteasomal ubiquitin-dependent protein catabolic process; protein autoubiquitination; protein polyubiquitination; response to UV

Disease: Mental Retardation, X-linked, Syndromic, Nascimento Type

Research Articles on UBE2A

Similar Products

Product Notes

The UBE2A ube2a (Catalog #AAA1271730) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccaccc cggctcggcg gcgcctcatg cgggacttca agaggttgca ggaggatcct ccagccggag tcagcggggc tccgtccgag aacaacataa tggtgtggaa cgcggtcatt ttcgggcctg aagggacccc gtttgaggat ggaacattta aacttacaat agaattcact gaagaatatc caaataaacc acctacagtt agatttgtct ctaagatgtt ccatccaaat gtctatgcag atggtagtat atgtctggac atacttcaga accgttggag tccaacctat gatgtgtctt ccattctaac atccatacag tctctgttgg atgaacccaa tcccaatagt ccagcaaaca gccaggctgc tcagctgtac caggagaaca aacgggaata tgaaaagcgt gtttctgcaa tagtagaaca aagctggcgt gattgttga. It is sometimes possible for the material contained within the vial of "UBE2A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.