Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GZMA cdna clone

GZMA cDNA Clone

Synonyms
GZMA; GZMA cDNA Clone; GZMA cdna clone
Ordering
For Research Use Only!
Sequence
atgaggaactcctatagatttctggcatcctctctctcagttgtcgtttctctcctgctaattcctgaagatgtctgtgaaaaaattattggaggaaatgaagtaactcctcattcaagaccctacatggtcctacttagtcttgacagaaaaaccatctgtgctggggctttgattgcaaaagactgggtgttgactgcagctcactgtaacttgaacaaaaggtcccaggtcattcttggggctcactcaataaccagggaagagccaacaaaacagataatgcttgttaagaaagagtttccctatccatgctatgacccagccacacgcgaaggtgaccttaaacttttacagctgacggaaaaagcaaaaattaacaaatatgtgactatccttcatctacctaaaaagggggatgatgtgaaaccaggaaccatgtgccaagttgcagggtggggcaggactcacaatagtgcatcttggtccgatactctgagagaagtcaatatcaccatcatagacagaaaagtctgcaatgatcgaaatcactataattttaaccctgtgattggaatgaatatggtttgtgctggaagcctccgaggtggaagagactcgtgcaatggagattctggaagccctttgttgtgcgagggtgttttccgaggggtcacttcctttggccttgaaaataaatgcggagaccctcgtgggcctggtgtctatattcttctctcaaagaaacacctcaactggataattatgactatcaagggagcagtttaa
Sequence Length
789
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,109 Da
NCBI Official Full Name
Homo sapiens granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3), mRNA
UniProt Protein Name
Granzyme A
Protein Family
UniProt Gene Name
GZMA
UniProt Synonym Gene Names
CTLA3; HFSP; H factor; HF
UniProt Entry Name
GRAA_HUMAN

Uniprot Description

GZMA: This enzyme is necessary for target cell lysis in cell- mediated immune responses. It cleaves after Lys or Arg. Cleaves APEX1 after 'Lys-31' and destroys its oxidative repair activity. Involved in apoptosis. Homodimer; disulfide-linked. Interacts with APEX1. Dexamethasone (DEX) induces expression of isoform beta and represses expression of isoform alpha. The alteration in expression is mediated by binding of glucocorticoid receptor to independent promoters adjacent to the alternative first exons of isoform alpha and isoform beta. Belongs to the peptidase S1 family. Granzyme subfamily. 2 isoforms of the human protein are produced by alternative promoter.

Protein type: EC 3.4.21.78; Protease; Apoptosis; Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 5q11-q12

Cellular Component: immunological synapse; nucleus

Molecular Function: protein binding; protein homodimerization activity; serine-type endopeptidase activity

Biological Process: apoptosis; immune response; negative regulation of DNA binding; negative regulation of endodeoxyribonuclease activity; negative regulation of oxidoreductase activity; positive regulation of apoptosis; proteolysis involved in cellular protein catabolic process

Similar Products

Product Notes

The GZMA gzma (Catalog #AAA1271698) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggaact cctatagatt tctggcatcc tctctctcag ttgtcgtttc tctcctgcta attcctgaag atgtctgtga aaaaattatt ggaggaaatg aagtaactcc tcattcaaga ccctacatgg tcctacttag tcttgacaga aaaaccatct gtgctggggc tttgattgca aaagactggg tgttgactgc agctcactgt aacttgaaca aaaggtccca ggtcattctt ggggctcact caataaccag ggaagagcca acaaaacaga taatgcttgt taagaaagag tttccctatc catgctatga cccagccaca cgcgaaggtg accttaaact tttacagctg acggaaaaag caaaaattaa caaatatgtg actatccttc atctacctaa aaagggggat gatgtgaaac caggaaccat gtgccaagtt gcagggtggg gcaggactca caatagtgca tcttggtccg atactctgag agaagtcaat atcaccatca tagacagaaa agtctgcaat gatcgaaatc actataattt taaccctgtg attggaatga atatggtttg tgctggaagc ctccgaggtg gaagagactc gtgcaatgga gattctggaa gccctttgtt gtgcgagggt gttttccgag gggtcacttc ctttggcctt gaaaataaat gcggagaccc tcgtgggcct ggtgtctata ttcttctctc aaagaaacac ctcaactgga taattatgac tatcaaggga gcagtttaa. It is sometimes possible for the material contained within the vial of "GZMA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.