Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDK8 cdna clone

CDK8 cDNA Clone

Gene Names
CDK8; K35
Synonyms
CDK8; CDK8 cDNA Clone; CDK8 cdna clone
Ordering
For Research Use Only!
Sequence
atggactatgactttaaagtgaagctgagcagcgagcgggagcgggtcgaggacctgtttgaatacgagggctgcaaagttggccgaggcacttatggtcacgtctacaaagccaagaggaaagatgggaaggatgataaagactatgctttaaaacaaatagaaggaactgggatctctatgtcggcatgtagagaaatagcattacttcgagagcttaagcatccaaacgtcatttctcttcaaaaggtgtttctgtctcatgctgataggaaggtgtggcttctgtttgactatgctgaacatgacctctggcatataatcaagtttcacagagcttctaaagcaaacaagaagccagttcagttacctcggggaatggtgaagtcactattatatcagatcctagatggtattcactacctgcatgctaactgggtgttgcacagagatttgaaacctgctaatattttagttatgggtgaaggtcctgagcgaggaagagtaaaaattgctgacatgggctttgcccgattatttaattcacctttgaagcctttagcagatttggatccagtggttgttacattctggtaccgagcccctgaactacttcttggagcaaggcattataccaaagctattgatatttgggctatagggtgtatatttgcagaactactaacgtcagaaccaatatttcactgtcgacaagaggacatcaaaactagtaatccttatcaccatgaccagctggacagaatattcaatgtaatgggatttcctgcagataaagattgggaagatataaaaaagatgcctgaacattcaacattaatgaaagatttcagaagaaatacgtataccaactgcagccttatcaagtatatggaaaaacataaagttaaaccagatagtaaagcattccacttgcttcagaagctgcttaccatggacccaataaagcgaattacctcagaacaggctatgcaggacccctatttcttagaagacccacttcctacatcagacgtttttgccggttgtcaaatcccttacccaaaacgagaatttttaacggaagaagaacctgatgacaaaggagacaaaaaccagcagcagcagcagggcaataaccacactaatggaactggccacccagggaatcaagacagcagtcacacacagggacccccgttgaagaaagtgagagttgttcctcctaccactacctcaggtggacttatcatgacctcagactatcagcgttccaatccacatgctgcctatcccaaccctggaccaagcacatcacagccgcagagcagcatgggatactcagctacctcccagcagcctccacagtactcacatcagacacatcggtactga
Sequence Length
1392
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,156 Da
NCBI Official Full Name
Homo sapiens cyclin-dependent kinase 8, mRNA
NCBI Official Synonym Full Names
cyclin dependent kinase 8
NCBI Official Symbol
CDK8
NCBI Official Synonym Symbols
K35
NCBI Protein Information
cyclin-dependent kinase 8
UniProt Protein Name
Cyclin-dependent kinase 8
Protein Family
UniProt Gene Name
CDK8
UniProt Entry Name
CDK8_HUMAN

NCBI Description

The protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe cdc2, and are known to be important regulators of cell cycle progression. This kinase and its regulatory subunit cyclin C are components of the RNA polymerase II holoenzyme complex, which phosphorylates the carboxy-terminal domain (CTD) of the largest subunit of RNA polymerase II. This kinase has also been shown to regulate transcription by targeting the CDK7/cyclin H subunits of the general transcription initiation factor IIH (TFIIH), thus providing a link between the 'Mediator-like' protein complexes and the basal transcription machinery. [provided by RefSeq, Jul 2008]

Uniprot Description

CDK8: a protein kinase of the CDK family. Along with cyclin C forms part of the RNA polymerase II holoenzyme complex. Phosphorylates the carboxy-terminal domain (CTD) of the largest subunit of RNA polymerase II. Regulates transcription by targeting the CDK7/cyclin H subunits of the general transcription initiation factor IIH (TFIIH), thus providing a link between the 'Mediator-like' protein complexes and the basal transcription machinery.

Protein type: Protein kinase, CMGC; Protein kinase, Ser/Thr (non-receptor); Kinase, protein; EC 2.7.11.22; Cell cycle regulation; EC 2.7.11.23; CMGC group; CDK family; CDK8 subfamily

Chromosomal Location of Human Ortholog: 13q12

Cellular Component: nucleoplasm; nucleus; Srb-mediator complex

Molecular Function: protein binding; protein kinase activity; protein serine/threonine kinase activity

Biological Process: positive regulation of transcription from RNA polymerase II promoter; transcription initiation from RNA polymerase II promoter

Research Articles on CDK8

Similar Products

Product Notes

The CDK8 cdk8 (Catalog #AAA1271577) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggactatg actttaaagt gaagctgagc agcgagcggg agcgggtcga ggacctgttt gaatacgagg gctgcaaagt tggccgaggc acttatggtc acgtctacaa agccaagagg aaagatggga aggatgataa agactatgct ttaaaacaaa tagaaggaac tgggatctct atgtcggcat gtagagaaat agcattactt cgagagctta agcatccaaa cgtcatttct cttcaaaagg tgtttctgtc tcatgctgat aggaaggtgt ggcttctgtt tgactatgct gaacatgacc tctggcatat aatcaagttt cacagagctt ctaaagcaaa caagaagcca gttcagttac ctcggggaat ggtgaagtca ctattatatc agatcctaga tggtattcac tacctgcatg ctaactgggt gttgcacaga gatttgaaac ctgctaatat tttagttatg ggtgaaggtc ctgagcgagg aagagtaaaa attgctgaca tgggctttgc ccgattattt aattcacctt tgaagccttt agcagatttg gatccagtgg ttgttacatt ctggtaccga gcccctgaac tacttcttgg agcaaggcat tataccaaag ctattgatat ttgggctata gggtgtatat ttgcagaact actaacgtca gaaccaatat ttcactgtcg acaagaggac atcaaaacta gtaatcctta tcaccatgac cagctggaca gaatattcaa tgtaatggga tttcctgcag ataaagattg ggaagatata aaaaagatgc ctgaacattc aacattaatg aaagatttca gaagaaatac gtataccaac tgcagcctta tcaagtatat ggaaaaacat aaagttaaac cagatagtaa agcattccac ttgcttcaga agctgcttac catggaccca ataaagcgaa ttacctcaga acaggctatg caggacccct atttcttaga agacccactt cctacatcag acgtttttgc cggttgtcaa atcccttacc caaaacgaga atttttaacg gaagaagaac ctgatgacaa aggagacaaa aaccagcagc agcagcaggg caataaccac actaatggaa ctggccaccc agggaatcaa gacagcagtc acacacaggg acccccgttg aagaaagtga gagttgttcc tcctaccact acctcaggtg gacttatcat gacctcagac tatcagcgtt ccaatccaca tgctgcctat cccaaccctg gaccaagcac atcacagccg cagagcagca tgggatactc agctacctcc cagcagcctc cacagtactc acatcagaca catcggtact ga. It is sometimes possible for the material contained within the vial of "CDK8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.