Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAB34 cdna clone

RAB34 cDNA Clone

Gene Names
RAB34; RAH; RAB39
Synonyms
RAB34; RAB34 cDNA Clone; RAB34 cdna clone
Ordering
For Research Use Only!
Sequence
atgaacattctggcacccgtgcggagggatcgcgtcctggcggagctgccccagtgcctgaggaaggaggccgctttgcacgggcacaaagacttccacccccgcgtcacctgcgcctgccaggagcaccggacaggcaccgtgggatttaagatctccaaggtcattgtggtgggggacctgtcggtggggaagacttgcctcattaataggttctgcaaagacacctttgataagaattacaaggccaccattggagtggacttcgagatggaacgatttgaggtgctgggcattcccttcagtttgcagctttgggataccgctgggcaggagaggttcaaatgcattgcatcaacctactatagaggagctcaagccatcatcattgtcttcaacctgaatgatgtggcatctctggaacataccaagcagtggctggccgatgccctgaaggagaatgacccttccagtgtgcttctcttccttacccctgctcagtatgcgctgatggagaaagacgccctccaggtggcccaggagatgaaggctgagtactgggcagtctcatctctcactggtgagaatgtccgagaattcttcttccgtgtggcagcactgacctttgaggccaatgtgctggctgagctggagaaatcgggggctcgacgcattggggatgttgtccgcatcaacagtgatgacagcaacctctacctaactgccagcaagaagaagcccacatgttgcccatga
Sequence Length
756
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,118 Da
NCBI Official Full Name
Homo sapiens RAB34, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB34, member RAS oncogene family
NCBI Official Symbol
RAB34
NCBI Official Synonym Symbols
RAH; RAB39
NCBI Protein Information
ras-related protein Rab-34
UniProt Protein Name
Ras-related protein Rab-34
Protein Family
UniProt Gene Name
RAB34
UniProt Synonym Gene Names
RAB39; RAH
UniProt Entry Name
RAB34_HUMAN

NCBI Description

This gene encodes a protein belonging to the RAB family of proteins, which are small GTPases involved in protein transport. This family member is a Golgi-bound member of the secretory pathway that is involved in the repositioning of lysosomes and the activation of macropinocytosis. Alternative splicing of this gene results in multiple transcript variants. This gene overlaps and shares exon structure with the nine-amino acid residue-repeats (NARR) gene, which encodes a functionally distinct nucleolar protein from a different reading frame. [provided by RefSeq, Jan 2012]

Uniprot Description

RAB34: Protein transport. Involved in the redistribution of lysosomes to the peri-Golgi region. Belongs to the small GTPase superfamily. Rab family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: G protein, monomeric, Rab; Nucleolus; G protein, monomeric

Chromosomal Location of Human Ortholog: 17q11.2

Cellular Component: Golgi apparatus; Golgi cisterna; Golgi stack; perinuclear region of cytoplasm; phagocytic vesicle; vesicle

Molecular Function: protein binding; Ral GTPase binding

Biological Process: antigen processing and presentation; Golgi to plasma membrane protein transport; lysosome localization

Research Articles on RAB34

Similar Products

Product Notes

The RAB34 rab34 (Catalog #AAA1271572) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacattc tggcacccgt gcggagggat cgcgtcctgg cggagctgcc ccagtgcctg aggaaggagg ccgctttgca cgggcacaaa gacttccacc cccgcgtcac ctgcgcctgc caggagcacc ggacaggcac cgtgggattt aagatctcca aggtcattgt ggtgggggac ctgtcggtgg ggaagacttg cctcattaat aggttctgca aagacacctt tgataagaat tacaaggcca ccattggagt ggacttcgag atggaacgat ttgaggtgct gggcattccc ttcagtttgc agctttggga taccgctggg caggagaggt tcaaatgcat tgcatcaacc tactatagag gagctcaagc catcatcatt gtcttcaacc tgaatgatgt ggcatctctg gaacatacca agcagtggct ggccgatgcc ctgaaggaga atgacccttc cagtgtgctt ctcttcctta cccctgctca gtatgcgctg atggagaaag acgccctcca ggtggcccag gagatgaagg ctgagtactg ggcagtctca tctctcactg gtgagaatgt ccgagaattc ttcttccgtg tggcagcact gacctttgag gccaatgtgc tggctgagct ggagaaatcg ggggctcgac gcattgggga tgttgtccgc atcaacagtg atgacagcaa cctctaccta actgccagca agaagaagcc cacatgttgc ccatga. It is sometimes possible for the material contained within the vial of "RAB34, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.