Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ICOSLG cdna clone

ICOSLG cDNA Clone

Gene Names
ICOSLG; B7H2; GL50; B7-H2; B7RP1; CD275; ICOSL; LICOS; B7RP-1; ICOS-L
Synonyms
ICOSLG; ICOSLG cDNA Clone; ICOSLG cdna clone
Ordering
For Research Use Only!
Sequence
atgcggctgggcagtcctggactgctcttcctgctcttcagcagccttcgagctgatactcaggagaaggaagtcagagcgatggtaggcagcgacgtggagctcagctgcgcttgccctgaaggaagccgttttgatttaaatgatgtttacgtatattggcaaaccagtgagtcgaaaaccgtggtgacctaccacatcccacagaacagctccttggaaaacgtggacagccgctaccggaaccgagccctgatgtcaccggccggcatgctgcggggcgacttctccctgcgcttgttcaacgtcaccccccaggacgagcagaagtttcactgcctggtgttgagccaatccctgggattccaggaggttttgagcgttgaggttacactgcatgtggcagcaaacttcagcgtgcccgtcgtcagcgccccccacagcccctcccaggatgagctcaccttcacgtgtacatccataaacggctaccccaggcccaacgtgtactggatcaataagacggacaacagcctgctggaccaggctctgcagaatgacaccgtcttcttgaacatgcggggcttgtatgacgtggtcagcgtgctgaggatcgcacggacccccagcgtgaacattggctgctgcatagagaacgtgcttctgcagcagaacctgactgtcggcagccagacaggaaatgacatcggagagagagacaagatcacagagaatccagtcagtaccggcgagaaaaacgcggccacgtggagcatcctggctgtcctgtgcctgcttgtggtcgtggcggtggccataggctgggtgtgcagggaccgatgcctccaacacagctatgcaggtgcctgggctgtgagtccggagacagagctcactggccacgtttga
Sequence Length
909
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,120 Da
NCBI Official Full Name
Homo sapiens inducible T-cell co-stimulator ligand, mRNA
NCBI Official Synonym Full Names
inducible T-cell costimulator ligand
NCBI Official Symbol
ICOSLG
NCBI Official Synonym Symbols
B7H2; GL50; B7-H2; B7RP1; CD275; ICOSL; LICOS; B7RP-1; ICOS-L
NCBI Protein Information
ICOS ligand
UniProt Protein Name
ICOS ligand
Protein Family
UniProt Gene Name
ICOSLG
UniProt Synonym Gene Names
B7H2; B7RP1; ICOSL; KIAA0653; B7-H2; B7RP-1
UniProt Entry Name
ICOSL_HUMAN

Uniprot Description

ICOSLG: Ligand for the T-cell-specific cell surface receptor ICOS. Acts as a costimulatory signal for T-cell proliferation and cytokine secretion; induces also B-cell proliferation and differentiation into plasma cells. Could play an important role in mediating local tissue responses to inflammatory conditions, as well as in modulating the secondary immune response by co- stimulating memory T-cell function. Belongs to the immunoglobulin superfamily. BTN/MOG family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 21q22.3

Cellular Component: plasma membrane

Molecular Function: receptor binding

Biological Process: positive regulation of activated T cell proliferation; T cell costimulation

Research Articles on ICOSLG

Similar Products

Product Notes

The ICOSLG icoslg (Catalog #AAA1271569) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcggctgg gcagtcctgg actgctcttc ctgctcttca gcagccttcg agctgatact caggagaagg aagtcagagc gatggtaggc agcgacgtgg agctcagctg cgcttgccct gaaggaagcc gttttgattt aaatgatgtt tacgtatatt ggcaaaccag tgagtcgaaa accgtggtga cctaccacat cccacagaac agctccttgg aaaacgtgga cagccgctac cggaaccgag ccctgatgtc accggccggc atgctgcggg gcgacttctc cctgcgcttg ttcaacgtca ccccccagga cgagcagaag tttcactgcc tggtgttgag ccaatccctg ggattccagg aggttttgag cgttgaggtt acactgcatg tggcagcaaa cttcagcgtg cccgtcgtca gcgcccccca cagcccctcc caggatgagc tcaccttcac gtgtacatcc ataaacggct accccaggcc caacgtgtac tggatcaata agacggacaa cagcctgctg gaccaggctc tgcagaatga caccgtcttc ttgaacatgc ggggcttgta tgacgtggtc agcgtgctga ggatcgcacg gacccccagc gtgaacattg gctgctgcat agagaacgtg cttctgcagc agaacctgac tgtcggcagc cagacaggaa atgacatcgg agagagagac aagatcacag agaatccagt cagtaccggc gagaaaaacg cggccacgtg gagcatcctg gctgtcctgt gcctgcttgt ggtcgtggcg gtggccatag gctgggtgtg cagggaccga tgcctccaac acagctatgc aggtgcctgg gctgtgagtc cggagacaga gctcactggc cacgtttga. It is sometimes possible for the material contained within the vial of "ICOSLG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.