TGOLN2 cdna clone
TGOLN2 cDNA Clone
Gene Names
TGOLN2; TGN38; TGN46; TGN48; TGN51; TTGN2
Synonyms
TGOLN2; TGOLN2 cDNA Clone; TGOLN2 cdna clone
Sequence
atgcggttcgtagttgccttggtcctcctgaacgtcgcagcggcgggagccgtgccgctcttggccaccgaaagcgtcaagcaagaagatgctggagtacggccttctgcaggaaacgtctccacccaccccagcttgagccaacggcctggaggctctaccaagtcgcatccggagccgcagactccaaaagacagccctagcaagtcgagtgcggaggcgcagaccccagaagacacccccaacaagtcgggtgcggaggcaaagacccaaaaagacagctccaacaagtcgggtgcggaggcaaagacccaaaaaggcagcactagcaagtcgggttcggaggcgcagaccacaaaagacagcactagtaagtcgcatccggagctgcagactccaaaagacagcactggcaaatcgggtgcggaggcgcagaccccagaagacagccccaacaggtcgggtgcggaggcaaagacccaaaaagacagccctagcaagtcaggttcggaggcgcagaccacaaaagatgtccctaataagtcgggtgcggacggccagaccccaaaagacggctccagcaagtcgggtgcggaggatcagaccccaaaagacgtccctaacaagtcgggtgcggagaagcagactccaaaagacggctctaacaagtccggtgcagaggagcagggcccaatagacgggcccagcaagtcgggtgcggaggagcagacctcaaaagacagccctaacaaggtggttccagagcagccttcccggaaagaccattccaagcccatctccaacccttctgataacaaggagctccccaaggctgacacaaaccagcttgctgacaaagggaagctttctcctcatgctttcaaaaccgaatctggggaggaaactgacctcatttctcccccgcaggaggaagttaagtcttcagagcctactgaggatgtggagcccaaagaggctgaagatgatgatacaggacccgaggagggctcaccgcccaaagaagagaaagaaaagatgtccggttctgcctccagtgagaaccgtgaagggacactttcggattccacgggtagcgagaaggatgacctttatccgaacggttctggaaatggcagcgcggagagcagccacttctttgcatatctggtgactgcagccattcttgtggctgtcctctatatcgctcatcacaacaagcggaagatcattgcttttgtcctggaaggaaaaagatctaaagtcacccggcggccaaaggccagtgactaccaacgtttggaccagaagtcctaa
Sequence Length
1314
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
29,541 Da
NCBI Official Full Name
Homo sapiens trans-golgi network protein 2, mRNA
NCBI Official Synonym Full Names
trans-golgi network protein 2
NCBI Official Symbol
TGOLN2
NCBI Official Synonym Symbols
TGN38; TGN46; TGN48; TGN51; TTGN2
NCBI Protein Information
trans-Golgi network integral membrane protein 2
UniProt Protein Name
Trans-Golgi network integral membrane protein 2
Protein Family
UniProt Gene Name
TGOLN2
UniProt Synonym Gene Names
TGN46; TGN51
UniProt Entry Name
TGON2_HUMAN
NCBI Description
This gene encodes a type I integral membrane protein that is localized to the trans-Golgi network, a major sorting station for secretory and membrane proteins. The encoded protein cycles between early endosomes and the trans-Golgi network, and may play a role in exocytic vesicle formation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
Uniprot Description
TGOLN2: May be involved in regulating membrane traffic to and from trans-Golgi network. 6 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral
Chromosomal Location of Human Ortholog: 2p11.2
Cellular Component: endosome; Golgi apparatus; nucleoplasm; trans-Golgi network; trans-Golgi network membrane; trans-Golgi network transport vesicle; transport vesicle
Molecular Function: protein binding
Biological Process: Golgi to endosome transport
Research Articles on TGOLN2
Similar Products
Product Notes
The TGOLN2 tgoln2 (Catalog #AAA1271559) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcggttcg tagttgcctt ggtcctcctg aacgtcgcag cggcgggagc cgtgccgctc ttggccaccg aaagcgtcaa gcaagaagat gctggagtac ggccttctgc aggaaacgtc tccacccacc ccagcttgag ccaacggcct ggaggctcta ccaagtcgca tccggagccg cagactccaa aagacagccc tagcaagtcg agtgcggagg cgcagacccc agaagacacc cccaacaagt cgggtgcgga ggcaaagacc caaaaagaca gctccaacaa gtcgggtgcg gaggcaaaga cccaaaaagg cagcactagc aagtcgggtt cggaggcgca gaccacaaaa gacagcacta gtaagtcgca tccggagctg cagactccaa aagacagcac tggcaaatcg ggtgcggagg cgcagacccc agaagacagc cccaacaggt cgggtgcgga ggcaaagacc caaaaagaca gccctagcaa gtcaggttcg gaggcgcaga ccacaaaaga tgtccctaat aagtcgggtg cggacggcca gaccccaaaa gacggctcca gcaagtcggg tgcggaggat cagaccccaa aagacgtccc taacaagtcg ggtgcggaga agcagactcc aaaagacggc tctaacaagt ccggtgcaga ggagcagggc ccaatagacg ggcccagcaa gtcgggtgcg gaggagcaga cctcaaaaga cagccctaac aaggtggttc cagagcagcc ttcccggaaa gaccattcca agcccatctc caacccttct gataacaagg agctccccaa ggctgacaca aaccagcttg ctgacaaagg gaagctttct cctcatgctt tcaaaaccga atctggggag gaaactgacc tcatttctcc cccgcaggag gaagttaagt cttcagagcc tactgaggat gtggagccca aagaggctga agatgatgat acaggacccg aggagggctc accgcccaaa gaagagaaag aaaagatgtc cggttctgcc tccagtgaga accgtgaagg gacactttcg gattccacgg gtagcgagaa ggatgacctt tatccgaacg gttctggaaa tggcagcgcg gagagcagcc acttctttgc atatctggtg actgcagcca ttcttgtggc tgtcctctat atcgctcatc acaacaagcg gaagatcatt gcttttgtcc tggaaggaaa aagatctaaa gtcacccggc ggccaaaggc cagtgactac caacgtttgg accagaagtc ctaa. It is sometimes possible for the material contained within the vial of "TGOLN2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
