Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FEN1 cdna clone

FEN1 cDNA Clone

Gene Names
FEN1; MF1; RAD2; FEN-1
Synonyms
FEN1; FEN1 cDNA Clone; FEN1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggaattcaaggcctggccaaactaattgctgatgtggcccccagtgccatccgggagaatgacatcaagagctactttggccgtaaggtggccattgatgcctctatgagcatttatcagttcctgattgctgttcgccagggtggggatgtgctgcagaatgaggagggtgagaccaccagccacctgatgggcatgttctaccgcaccattcgcatgatggagaacggcatcaagcccgtgtatgtctttgatggcaagccgccacagctcaagtcaggcgagctggccaaacgcagtgagcggcgggctgaggcagagaagcagctgcagcaggctcaggctgctggggccgagcaggaggtggaaaaattcactaagcggctggtgaaggtcactaagcagcacaatgatgagtgcaaacatctgctgagcctcatgggcatcccttatcttgatgcacccagtgaggcagaggccagctgtgctgccctggtgaaggctggcaaagtctatgctgcggctaccgaggacatggactgcctcaccttcggcagccctgtgctaatgcgacacctgactgccagtgaagccaaaaagctgccaatccaggaattccacctgagccggattctgcaggagctgggcctgaaccaggaacagtttgtggatctgtgcatcctgctaggcagtgactactgtgagagtatccggggtattgggcccaagcgggctgtggacctcatccagaagcacaagagcatcgaggagatcgtgcggcgacttgaccccaacaagtaccctgtgccagaaaattggctccacaaggaggctcaccagctcttcttggaacctgaggtgctggacccagagtctgtggagctgaagtggagcgagccaaatgaagaagagctgatcaagttcatgtgtggtgaaaagcagttctctgaggagcgaatccgcagtggggtcaagaggctgagtaagagccgccaaggcagcacccagggccgcctggatgatttcttcaaggtgaccggctcactctcttcagctaagcgcaaggagccagaacccaagggatccactaagaagaaggcaaagactggggcagcagggaagtttaaaaggggaaaataa
Sequence Length
1143
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,673 Da
NCBI Official Full Name
Homo sapiens flap structure-specific endonuclease 1, mRNA
NCBI Official Synonym Full Names
flap structure-specific endonuclease 1
NCBI Official Symbol
FEN1
NCBI Official Synonym Symbols
MF1; RAD2; FEN-1
NCBI Protein Information
flap endonuclease 1
UniProt Protein Name
Flap endonuclease 1
UniProt Gene Name
FEN1
UniProt Synonym Gene Names
FEN-1; MF1
UniProt Entry Name
FEN1_HUMAN

NCBI Description

The protein encoded by this gene removes 5' overhanging flaps in DNA repair and processes the 5' ends of Okazaki fragments in lagging strand DNA synthesis. Direct physical interaction between this protein and AP endonuclease 1 during long-patch base excision repair provides coordinated loading of the proteins onto the substrate, thus passing the substrate from one enzyme to another. The protein is a member of the XPG/RAD2 endonuclease family and is one of ten proteins essential for cell-free DNA replication. DNA secondary structure can inhibit flap processing at certain trinucleotide repeats in a length-dependent manner by concealing the 5' end of the flap that is necessary for both binding and cleavage by the protein encoded by this gene. Therefore, secondary structure can deter the protective function of this protein, leading to site-specific trinucleotide expansions. [provided by RefSeq, Jul 2008]

Uniprot Description

FEN1: Structure-specific nuclease with 5'-flap endonuclease and 5'-3' exonuclease activities involved in DNA replication and repair. During DNA replication, cleaves the 5'-overhanging flap structure that is generated by displacement synthesis when DNA polymerase encounters the 5'-end of a downstream Okazaki fragment. It enters the flap from the 5'-end and then tracks to cleave the flap base, leaving a nick for ligation. Also involved in the long patch base excision repair (LP-BER) pathway, by cleaving within the apurinic/apyrimidinic (AP) site-terminated flap. Acts as a genome stabilization factor that prevents flaps from equilibrating into structurs that lead to duplications and deletions. Also possesses 5'-3' exonuclease activity on nicked or gapped double- stranded DNA, and exhibits RNase H activity. Also involved in replication and repair of rDNA and in repairing mitochondrial DNA. Interacts with PCNA. Three molecules of FEN1 bind to one PCNA trimer with each molecule binding to one PCNA monomer. PCNA stimulates the nuclease activity without altering cleavage specificity. The C-terminal domain binds EP300. Can bind simultaneously to both PCNA and EP300. Interacts with DDX11. Belongs to the XPG/RAD2 endonuclease family. FEN1 subfamily.

Protein type: Nucleolus; Nuclear receptor co-regulator; EC 3.1.-.-; Ribonuclease; DNA-binding; DNA repair, damage; Deoxyribonuclease

Chromosomal Location of Human Ortholog: 11q12

Cellular Component: membrane; mitochondrion; nuclear chromosome, telomeric region; nucleolus; nucleoplasm; nucleus; plasma membrane; protein complex

Molecular Function: 5'-3' exonuclease activity; 5'-flap endonuclease activity; damaged DNA binding; DNA binding; double-stranded DNA binding; double-stranded DNA specific exodeoxyribonuclease activity; endonuclease activity; exonuclease activity; protein binding; ribonuclease H activity

Biological Process: DNA repair; DNA replication; DNA replication, removal of RNA primer; double-strand break repair; double-strand break repair via homologous recombination; telomere maintenance via recombination; UV protection

Research Articles on FEN1

Similar Products

Product Notes

The FEN1 fen1 (Catalog #AAA1271477) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggaattc aaggcctggc caaactaatt gctgatgtgg cccccagtgc catccgggag aatgacatca agagctactt tggccgtaag gtggccattg atgcctctat gagcatttat cagttcctga ttgctgttcg ccagggtggg gatgtgctgc agaatgagga gggtgagacc accagccacc tgatgggcat gttctaccgc accattcgca tgatggagaa cggcatcaag cccgtgtatg tctttgatgg caagccgcca cagctcaagt caggcgagct ggccaaacgc agtgagcggc gggctgaggc agagaagcag ctgcagcagg ctcaggctgc tggggccgag caggaggtgg aaaaattcac taagcggctg gtgaaggtca ctaagcagca caatgatgag tgcaaacatc tgctgagcct catgggcatc ccttatcttg atgcacccag tgaggcagag gccagctgtg ctgccctggt gaaggctggc aaagtctatg ctgcggctac cgaggacatg gactgcctca ccttcggcag ccctgtgcta atgcgacacc tgactgccag tgaagccaaa aagctgccaa tccaggaatt ccacctgagc cggattctgc aggagctggg cctgaaccag gaacagtttg tggatctgtg catcctgcta ggcagtgact actgtgagag tatccggggt attgggccca agcgggctgt ggacctcatc cagaagcaca agagcatcga ggagatcgtg cggcgacttg accccaacaa gtaccctgtg ccagaaaatt ggctccacaa ggaggctcac cagctcttct tggaacctga ggtgctggac ccagagtctg tggagctgaa gtggagcgag ccaaatgaag aagagctgat caagttcatg tgtggtgaaa agcagttctc tgaggagcga atccgcagtg gggtcaagag gctgagtaag agccgccaag gcagcaccca gggccgcctg gatgatttct tcaaggtgac cggctcactc tcttcagcta agcgcaagga gccagaaccc aagggatcca ctaagaagaa ggcaaagact ggggcagcag ggaagtttaa aaggggaaaa taa. It is sometimes possible for the material contained within the vial of "FEN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.