PUS7 cdna clone
PUS7 cDNA Clone
Synonyms
PUS7; PUS7 cDNA Clone; PUS7 cdna clone
Sequence
atggatttaatattgaaaccccgctctggagctgaaaagggctacttggttaaatgcagagaagaatgggcaaagaccaaagacccaactgctgccctcagaaaactacctgtcaaaaggtgtgtggaagggcagctgcttcgaggactttcaaaatatggaatgaagaatatagtctctgcatttggcataatacccagaaataatcgcttaatgtatattcatagctaccaaagctatgtgtggaataacatggtaagcaagaggatagaagactatggactaaaacctgttccaggggacctcgttctcaaaggagccacagccacctatattgaggaagatgatgttaataattactctatccatgatgtggtaatgcccttgcctggtttcgatgttatctacccaaagcataaaattcaagaagcctacagggaaatgctcacagctgacaatcttgatattgacaacatgagacacaaaattcgagattattccttgtcaggggcctaccgaaagatcattattcgtcctcagaatgttagctgggaagtcgttgcatatgatgatcccaaaattccacttttcaacacagatgtggacaacctagaagggaagacaccaccagtttttgcttctgaaggcaaatacagggctctgaaaatggatttttctctacccccttctacttacgccaccatggccattcgagaagtgctaaaaatggataccagtatcaagaaccagacgcagctgaatacaacctggcttcgctga
Sequence Length
780
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
75,035 Da
NCBI Official Full Name
Homo sapiens pseudouridylate synthase 7 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
pseudouridylate synthase 7 (putative)
NCBI Official Symbol
PUS7
NCBI Protein Information
pseudouridylate synthase 7 homolog
UniProt Protein Name
Pseudouridylate synthase 7 homolog
Protein Family
UniProt Gene Name
PUS7
UniProt Synonym Gene Names
KIAA1897
UniProt Entry Name
PUS7_HUMAN
Uniprot Description
PUS7: Belongs to the pseudouridine synthase TruD family.
Protein type: EC 5.4.99.-; Isomerase
Chromosomal Location of Human Ortholog: 7q22.3
Cellular Component: nucleus
Molecular Function: enzyme binding; pseudouridine synthase activity
Biological Process: pseudouridine synthesis
Research Articles on PUS7
Similar Products
Product Notes
The PUS7 pus7 (Catalog #AAA1271463) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatttaa tattgaaacc ccgctctgga gctgaaaagg gctacttggt taaatgcaga gaagaatggg caaagaccaa agacccaact gctgccctca gaaaactacc tgtcaaaagg tgtgtggaag ggcagctgct tcgaggactt tcaaaatatg gaatgaagaa tatagtctct gcatttggca taatacccag aaataatcgc ttaatgtata ttcatagcta ccaaagctat gtgtggaata acatggtaag caagaggata gaagactatg gactaaaacc tgttccaggg gacctcgttc tcaaaggagc cacagccacc tatattgagg aagatgatgt taataattac tctatccatg atgtggtaat gcccttgcct ggtttcgatg ttatctaccc aaagcataaa attcaagaag cctacaggga aatgctcaca gctgacaatc ttgatattga caacatgaga cacaaaattc gagattattc cttgtcaggg gcctaccgaa agatcattat tcgtcctcag aatgttagct gggaagtcgt tgcatatgat gatcccaaaa ttccactttt caacacagat gtggacaacc tagaagggaa gacaccacca gtttttgctt ctgaaggcaa atacagggct ctgaaaatgg atttttctct acccccttct acttacgcca ccatggccat tcgagaagtg ctaaaaatgg ataccagtat caagaaccag acgcagctga atacaacctg gcttcgctga. It is sometimes possible for the material contained within the vial of "PUS7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
