Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KLHL12 cdna clone

KLHL12 cDNA Clone

Gene Names
KLHL12; DKIR; C3IP1
Synonyms
KLHL12; KLHL12 cDNA Clone; KLHL12 cdna clone
Ordering
For Research Use Only!
Sequence
atgggaggcattatggcccccaaagacataatgacaaatactcatgctaaatccatcctcaattcaatgaactccctcaggaagagcaataccctctgtgatgtgacattgagagtagagcagaaagacttccctgcccatcggattgtgctggctgcctgtagtgattacttctgtgccatgttcactagtgagctctcagagaaggggaaaccttatgttgacatccaaggtttgactgcctctaccatggaaattttattggactttgtgtacacagaaacagtacatgtgacagtggagaatgtacaagaactgcttcctgcagcctgtctgcttcagttgaaaggtgtgaaacaagcctgctgtgagttcttagaaagtcagttggacccttctaattgcctgggtattagggattttgctgaaacccacaattgtgttgacctgatgcaagcagctgaggtttttagccagaagcattttcctgaagtggtacagcatgaagagttcattcttctgagtcaaggagaggtggaaaagctaatcaagtgcgacgaaattcaggtggattctgaagagccagtctttgaggctgtcatcaactgggtgaagcatgccaagaaagagcgggaagaatccttgcctaacctgctacagtatgtgcggatgcccctactaacccccaggtatatcacagatgtaatagatgctgagcctttcatccgctgtagtttacaatgcagggatctggttgatgaagcaaagaagtttcatctgaggcctgaacttcggagtcagatgcagggacccaggacaagggctcgcctaggagccaatgaagtgcttttggtggttgggggctttggaagccagcagtctcccattgatgtggtagagaaatatgaccccaagactcaggagtggagctttttgccaagcatcactcgtaagagacgttatgtggcctcagtgtcccttcatgaccggatctacgtcattggtggctatgatggccgttcccgccttagttcagtggaatgtctagactacacagcagatgaggatggggtctggtattctgtggcccctatgaatgtccgacgaggtcttgctggagccaccaccctgggagatatgatctatgtctctggaggctttgatggaagcaggcgtcacaccagtatggagcgctatgatccaaacattgaccagtggagcatgctgggagatatgcagacagcccgggaaggtgccggactcgtagtggccagtggagtgatctactgtctaggaggatatgacggcttgaatatcttaaattcagttgagaaatacgaccctcatacaggacattggactaatgttacaccaatggccaccaagcgttctggtgcaggagtagccctgctgaatgaccatatttatgtggtggggggatttgatggtacagcccacctttcttccgttgaagcatacaacattcgcactgattcctggacaactgtcaccagtatgaccactccacgatgctatgtaggggccacagtgcttcgggggagactctatgcaattgcaggatatgatggtaattccctgctaagtagcattgaatgttatgaccctatcatcgacagctgggaagtcgtgacatccatgggaacccagcgctgtgatgctggtgtttgtgttctccgcgagaagtga
Sequence Length
1707
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
67,727 Da
NCBI Official Full Name
Homo sapiens kelch-like 12 (Drosophila), mRNA
NCBI Official Synonym Full Names
kelch like family member 12
NCBI Official Symbol
KLHL12
NCBI Official Synonym Symbols
DKIR; C3IP1
NCBI Protein Information
kelch-like protein 12
UniProt Protein Name
Kelch-like protein 12
Protein Family
UniProt Gene Name
KLHL12
UniProt Synonym Gene Names
C3IP1; hDKIR
UniProt Entry Name
KLH12_HUMAN

NCBI Description

This gene encodes a member of the KLHL (Kelch-like) family of proteins. This protein has been identified as an autoantigen in the autoimmune disease Sjogren's syndrome and as a potential biomarker in primary biliary cirrhosis. This protein may act as a substrate adaptor of the Cullin-3 ubiquitin ligase complex to promote substrate-specific ubiquitylation. Ubiquitylation by this complex has been shown to regulate the Wnt signaling pathway as well as COPII vesicle coat size. A pseudogene has been identified on chromosome 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]

Uniprot Description

KLHL12: Substrate-specific adapter of a BCR (BTB-CUL3-RBX1) E3 ubiquitin ligase complex that acts as a negative regulator of Wnt signaling pathway and ER-Golgi transport. The BCR(KLHL12) complex is involved in ER-Golgi transport by regulating the size of COPII coats, thereby playing a key role in collagen export, which is required for embryonic stem (ES) cells division: BCR(KLHL12) acts by mediating monoubiquitination of SEC31 (SEC31A or SEC31B). As part of the BCR(KLHL12) complex, also acts as a negative regulator of the Wnt signaling pathway by mediating ubiquitination and subsequent proteolysis of DVL3. The BCR(KLHL12) complex also mediates polyubiquitination of DRD4, without leading to degradation of DRD4. Component of the BCR(KLHL12) E3 ubiquitin ligase complex, at least composed of CUL3 and KLHL12 and RBX1. This complex interacts with DVL3 upon activation of the Wnt signaling pathway by WNT3A. Interacts with DRD4, KLHL12 and SEC31A. Ubiquitously expressed. Highly expressed in testis and at lower levels in the submandibular salivary gland. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 1q32.1

Cellular Component: cytosol; ER to Golgi transport vesicle; intracellular membrane-bound organelle; microtubule organizing center

Molecular Function: identical protein binding; protein binding; ubiquitin-protein ligase activity

Biological Process: COPII coating of Golgi vesicle; ER to Golgi vesicle-mediated transport; protein monoubiquitination; Wnt receptor signaling pathway

Research Articles on KLHL12

Similar Products

Product Notes

The KLHL12 klhl12 (Catalog #AAA1271450) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggaggca ttatggcccc caaagacata atgacaaata ctcatgctaa atccatcctc aattcaatga actccctcag gaagagcaat accctctgtg atgtgacatt gagagtagag cagaaagact tccctgccca tcggattgtg ctggctgcct gtagtgatta cttctgtgcc atgttcacta gtgagctctc agagaagggg aaaccttatg ttgacatcca aggtttgact gcctctacca tggaaatttt attggacttt gtgtacacag aaacagtaca tgtgacagtg gagaatgtac aagaactgct tcctgcagcc tgtctgcttc agttgaaagg tgtgaaacaa gcctgctgtg agttcttaga aagtcagttg gacccttcta attgcctggg tattagggat tttgctgaaa cccacaattg tgttgacctg atgcaagcag ctgaggtttt tagccagaag cattttcctg aagtggtaca gcatgaagag ttcattcttc tgagtcaagg agaggtggaa aagctaatca agtgcgacga aattcaggtg gattctgaag agccagtctt tgaggctgtc atcaactggg tgaagcatgc caagaaagag cgggaagaat ccttgcctaa cctgctacag tatgtgcgga tgcccctact aacccccagg tatatcacag atgtaataga tgctgagcct ttcatccgct gtagtttaca atgcagggat ctggttgatg aagcaaagaa gtttcatctg aggcctgaac ttcggagtca gatgcaggga cccaggacaa gggctcgcct aggagccaat gaagtgcttt tggtggttgg gggctttgga agccagcagt ctcccattga tgtggtagag aaatatgacc ccaagactca ggagtggagc tttttgccaa gcatcactcg taagagacgt tatgtggcct cagtgtccct tcatgaccgg atctacgtca ttggtggcta tgatggccgt tcccgcctta gttcagtgga atgtctagac tacacagcag atgaggatgg ggtctggtat tctgtggccc ctatgaatgt ccgacgaggt cttgctggag ccaccaccct gggagatatg atctatgtct ctggaggctt tgatggaagc aggcgtcaca ccagtatgga gcgctatgat ccaaacattg accagtggag catgctggga gatatgcaga cagcccggga aggtgccgga ctcgtagtgg ccagtggagt gatctactgt ctaggaggat atgacggctt gaatatctta aattcagttg agaaatacga ccctcataca ggacattgga ctaatgttac accaatggcc accaagcgtt ctggtgcagg agtagccctg ctgaatgacc atatttatgt ggtgggggga tttgatggta cagcccacct ttcttccgtt gaagcataca acattcgcac tgattcctgg acaactgtca ccagtatgac cactccacga tgctatgtag gggccacagt gcttcggggg agactctatg caattgcagg atatgatggt aattccctgc taagtagcat tgaatgttat gaccctatca tcgacagctg ggaagtcgtg acatccatgg gaacccagcg ctgtgatgct ggtgtttgtg ttctccgcga gaagtga. It is sometimes possible for the material contained within the vial of "KLHL12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.