Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DYRK4 cdna clone

DYRK4 cDNA Clone

Synonyms
DYRK4; DYRK4 cDNA Clone; DYRK4 cdna clone
Ordering
For Research Use Only!
Sequence
atgccggcctcagagctcaaggcttcagaaatacctttccaccctagcattaaaacccaggatcccaaggcagaggagaagtcaccaaagaagcaaaaggtgactctgacagcggcagaggccctaaagctttttaagaaccagctgtctccatatgaacaaagtgaaatcctgggctacgcggagctgtggttcctgggtcttgaagccaagaagctcgacacggctcctgagaaatttagcaagacgagttttgatgatgagcatggcttctatctgaaggttctgcatgatcacattgcctaccgctatgaagttctggagacaatcgggaaggggtcctttggacaggtggccaagtgcttggatcacaaaaacaatgagctggtggccctgaaaatcatcaggaacaagaagaggtttcaccagcaggccctgatggagctgaagatcctggaagctctcagaaagaaggacaaagacaacacctacaatgtggtgcatatgaaggactttttctactttcgcaatcacttctgcatcacctttgagctcctgggaatcaacttgtatgagttgatgaagaataacaactttcaaggcttcagtctgtccatagttcggcgcttcactctctctgttttgaagtgcttgcagatgctttcggtagagaaaatcattcactgtgatctcaagcccgaaaatatagtgctataccaaaagggccaagcctctgttaaagtcattgactttggatcaagctgttatgaacaccagaaagtatacacgtacatccaaagccggttctaccgatccccagaagtgatcctgggccacccctacgacgtggccattgacatgtggagcctgggctgcatcacggcggagttgtacacgggctaccccctgttccccggggagaatgaggtggagcagctggcctgcatcatggaggtgctgggtctgccgccagccggcttcattcagacagcctccaggagacagacattctttgattccaaaggttttcctaaaaatataaccaacaacagggggaaaaaaagatacccagattccaaggacctcacgatggtgctgaaaacctatgacaccagcttcctggactttctcagaaggtgtttggtatgggaaccttctcttcgcatgaccccggaccaggccctcaagcatgcttggattcatcagtctcggaacctcaagccacagcccaggccccagaccctgaggaaatccaattcctttttcccctctgagacaaggaaggacaaggttcaaggctgtcatcactcgagcagaaaagcagatgagatcaccaaagagactacagagaaaacaaaagatagccccacgaagcatgttcagcattcaggtgatcagcaggactgtctccagcacggagctgacactgttcagctgcctcaactggtagacgctcccaagaagtcagaggcagctgtcggggcggaggtgtccatgacctccccaggacagagcaaaaacttctccctcaagaacacaaacgttttaccccctattgtatga
Sequence Length
1563
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,293 Da
NCBI Official Full Name
Homo sapiens dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4, mRNA
NCBI Official Synonym Full Names
dual specificity tyrosine phosphorylation regulated kinase 4
NCBI Official Symbol
DYRK4
NCBI Protein Information
dual specificity tyrosine-phosphorylation-regulated kinase 4
UniProt Protein Name
Dual specificity tyrosine-phosphorylation-regulated kinase 4
UniProt Gene Name
DYRK4
UniProt Entry Name
DYRK4_HUMAN

NCBI Description

This gene encodes an enzyme that belongs to a conserved family of serine/threonine protein kinases. Members of this dual specificity kinase family are thought to function in the regulation of cell differentiation and proliferation, survival, and in development. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Aug 2013]

Uniprot Description

DYRK4: a dual-specificity protein kinase of the DYRK family. Its expression is up-regulated by retinoic-acid-induced differentiation of a human neuronal precursor teratocarcinoma cell line.

Protein type: EC 2.7.12.1; Protein kinase, CMGC; Kinase, protein; Protein kinase, dual-specificity (non-receptor); CMGC group; DYRK family; Dyrk2 subfamily

Chromosomal Location of Human Ortholog: 12p13.32

Cellular Component: intracellular membrane-bound organelle

Molecular Function: protein binding

Research Articles on DYRK4

Similar Products

Product Notes

The DYRK4 dyrk4 (Catalog #AAA1271398) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccggcct cagagctcaa ggcttcagaa atacctttcc accctagcat taaaacccag gatcccaagg cagaggagaa gtcaccaaag aagcaaaagg tgactctgac agcggcagag gccctaaagc tttttaagaa ccagctgtct ccatatgaac aaagtgaaat cctgggctac gcggagctgt ggttcctggg tcttgaagcc aagaagctcg acacggctcc tgagaaattt agcaagacga gttttgatga tgagcatggc ttctatctga aggttctgca tgatcacatt gcctaccgct atgaagttct ggagacaatc gggaaggggt cctttggaca ggtggccaag tgcttggatc acaaaaacaa tgagctggtg gccctgaaaa tcatcaggaa caagaagagg tttcaccagc aggccctgat ggagctgaag atcctggaag ctctcagaaa gaaggacaaa gacaacacct acaatgtggt gcatatgaag gactttttct actttcgcaa tcacttctgc atcacctttg agctcctggg aatcaacttg tatgagttga tgaagaataa caactttcaa ggcttcagtc tgtccatagt tcggcgcttc actctctctg ttttgaagtg cttgcagatg ctttcggtag agaaaatcat tcactgtgat ctcaagcccg aaaatatagt gctataccaa aagggccaag cctctgttaa agtcattgac tttggatcaa gctgttatga acaccagaaa gtatacacgt acatccaaag ccggttctac cgatccccag aagtgatcct gggccacccc tacgacgtgg ccattgacat gtggagcctg ggctgcatca cggcggagtt gtacacgggc taccccctgt tccccgggga gaatgaggtg gagcagctgg cctgcatcat ggaggtgctg ggtctgccgc cagccggctt cattcagaca gcctccagga gacagacatt ctttgattcc aaaggttttc ctaaaaatat aaccaacaac agggggaaaa aaagataccc agattccaag gacctcacga tggtgctgaa aacctatgac accagcttcc tggactttct cagaaggtgt ttggtatggg aaccttctct tcgcatgacc ccggaccagg ccctcaagca tgcttggatt catcagtctc ggaacctcaa gccacagccc aggccccaga ccctgaggaa atccaattcc tttttcccct ctgagacaag gaaggacaag gttcaaggct gtcatcactc gagcagaaaa gcagatgaga tcaccaaaga gactacagag aaaacaaaag atagccccac gaagcatgtt cagcattcag gtgatcagca ggactgtctc cagcacggag ctgacactgt tcagctgcct caactggtag acgctcccaa gaagtcagag gcagctgtcg gggcggaggt gtccatgacc tccccaggac agagcaaaaa cttctccctc aagaacacaa acgttttacc ccctattgta tga. It is sometimes possible for the material contained within the vial of "DYRK4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.