Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDC42EP3 cdna clone

CDC42EP3 cDNA Clone

Gene Names
CDC42EP3; UB1; CEP3; BORG2
Synonyms
CDC42EP3; CDC42EP3 cDNA Clone; CDC42EP3 cdna clone
Ordering
For Research Use Only!
Sequence
atgccagccaagaccccaatttacctgaaagcagccaataacaagaaaggaaagaaatttaaactgagggacattctgtctcctgatatgatcagtcccccgcttggagactttcgccacaccatccacattggcaaagagggccagcacgatgtctttggagatatttcctttcttcaagggaactacgagcttttacctggaaaccaggagaaagcacacctgggccagttccctgggcataatgagttcttccgggccaacagcacctcggactctgtgttcacagaaacgccctccccggtgctcaaaaatgccatctccctcccgaccattggaggatcccaagctctcatgttgcccttattgtcaccagtgacatttaattccaaacaggagtccttcgggccagcaaagctgcccaggcttagctgcgagcccgtcatggaggaaaaagctcaggagaaaagcagtctgttggagaatgggacagtccaccagggagacacctcgtggggctccagcggttctgcatctcagtccagccaaggcagagacagccactcctccagcctgtccgaacagtaccccgactggccagccgaggacatgtttgaccatcccaccccatgcgagctcatcaagggaaagactaagtcagaggagtccctctctgaccttacaggttccctcctctccctgcagcttgatcttgggccctcacttttggatgaggtgctgaatgtaatggataaaaataagtaa
Sequence Length
765
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,678 Da
NCBI Official Full Name
Homo sapiens CDC42 effector protein (Rho GTPase binding) 3, mRNA
NCBI Official Synonym Full Names
CDC42 effector protein 3
NCBI Official Symbol
CDC42EP3
NCBI Official Synonym Symbols
UB1; CEP3; BORG2
NCBI Protein Information
cdc42 effector protein 3
UniProt Protein Name
Cdc42 effector protein 3
Protein Family
UniProt Gene Name
CDC42EP3
UniProt Synonym Gene Names
BORG2; CEP3
UniProt Entry Name
BORG2_HUMAN

NCBI Description

This gene encodes a member of a small family of guanosine triphosphate (GTP) metabolizing proteins that contain a CRIB (Cdc42, Rac interactive binding) domain. Members of this family of proteins act as effectors of CDC42 function. The encoded protein is involved in actin cytoskeleton re-organization during cell shape changes, including pseudopodia formation. A pseudogene of this gene is found on chromosome 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]

Uniprot Description

CDC42EP3: Probably involved in the organization of the actin cytoskeleton. May act downstream of CDC42 to induce actin filament assembly leading to cell shape changes. Induces pseudopodia formation in fibroblasts. Belongs to the BORG/CEP family.

Protein type: G protein regulator, misc.

Chromosomal Location of Human Ortholog: 2p21

Cellular Component: actin cytoskeleton; cytoplasm; cytosol; plasma membrane

Molecular Function: cytoskeletal regulatory protein binding; GTP-Rho binding; GTPase activator activity

Biological Process: positive regulation of actin filament polymerization; positive regulation of pseudopodium formation; regulation of cell shape; Rho protein signal transduction; signal transduction

Research Articles on CDC42EP3

Similar Products

Product Notes

The CDC42EP3 cdc42ep3 (Catalog #AAA1271371) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccagcca agaccccaat ttacctgaaa gcagccaata acaagaaagg aaagaaattt aaactgaggg acattctgtc tcctgatatg atcagtcccc cgcttggaga ctttcgccac accatccaca ttggcaaaga gggccagcac gatgtctttg gagatatttc ctttcttcaa gggaactacg agcttttacc tggaaaccag gagaaagcac acctgggcca gttccctggg cataatgagt tcttccgggc caacagcacc tcggactctg tgttcacaga aacgccctcc ccggtgctca aaaatgccat ctccctcccg accattggag gatcccaagc tctcatgttg cccttattgt caccagtgac atttaattcc aaacaggagt ccttcgggcc agcaaagctg cccaggctta gctgcgagcc cgtcatggag gaaaaagctc aggagaaaag cagtctgttg gagaatggga cagtccacca gggagacacc tcgtggggct ccagcggttc tgcatctcag tccagccaag gcagagacag ccactcctcc agcctgtccg aacagtaccc cgactggcca gccgaggaca tgtttgacca tcccacccca tgcgagctca tcaagggaaa gactaagtca gaggagtccc tctctgacct tacaggttcc ctcctctccc tgcagcttga tcttgggccc tcacttttgg atgaggtgct gaatgtaatg gataaaaata agtaa. It is sometimes possible for the material contained within the vial of "CDC42EP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.