Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CREB3L1 cdna clone

CREB3L1 cDNA Clone

Gene Names
CREB3L1; OASIS
Synonyms
CREB3L1; CREB3L1 cDNA Clone; CREB3L1 cdna clone
Ordering
For Research Use Only!
Sequence
atggacgccgtcttggaacccttcccggccgacaggctgttccccggatccagcttcctggacttgggggatctgaacgagtcggacttcctcaacaatgcgcactttcctgagcacctggaccactttacggagaacatggaggacttctccaatgacctgttcagcagcttctttgatgaccctgtgctggatgagaagagccctctattggacatggaactggactcccctacgccaggcatccaggcggagcacagctactccctgagcggcgactcagcgccccagagcccccttgtgcccatcaagatggaggacaccacccaagatgcagagcatggagcatgggcgctgggacacaaactgtgctccatcatggtgaagcaggagcagagcccggagctgcccgtggaccctctggctgccccctcggccatggctgccgcggccgccatggccaccaccccgctgctgggcctcagccccttgtccaggctgcccatcccccaccaggccccgggagagatgactcagctgccagtgatcaaagcagagcctctggaggtgaaccagttcctcaaagtgacaccggaggacctggtgcagatgcctccgacgccccccagcagccatggcagtgacagcgacggctcccagagtccccgctctctgcccccctccagccctgtcaggcccatggcgcgctcctccacggccatctccacctccccactcctcactgcccctcacaaattacaggggacatcagggccactgctcctgacagaggaggagaagcggaccctgattgctgagggctaccccatccccacaaaactccccctcaccaaagccgaggagaaggccttgaagagagtccggaggaaaatcaagaacaagatctcagcccaggagagccgtcgtaagaagaaggagtatgtggagtgtctagaaaagaaggtggagacatttacatctgagaacaatgaactgtggaagaaggtggagaccctggagaatgccaacaggaccctgctccagcagctgcagaaactccagactctggtcaccaacaagatctccagaccttacaagatggccgccacccagactgggacctgcctcatggtggcagccttgtgctttgttctggtgctgggctccctcgtgccctgccttcccgagttctcctccggctcccagactgtgaaggaagaccccctggccgcagacggcgtctacacggccagccagatgccctcccgaagcctcctattctacgatgacggggcaggcttatgggaagatggccgcagcaccctgctgcccatggagcccccagatggctgggaaatcaaccccggggggccggcagagcagcggccccgggaccacctgcagcatgatcacctggacagcacccacgagaccaccaagtacctgagtgaggcctggcctaaagacggtggaaacggcaccagccccgacttctcccactccaaggagtggttccacgacagggatctgggccccaacaccaccatcaaactctcctag
Sequence Length
1560
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,783 Da
NCBI Official Full Name
Homo sapiens cAMP responsive element binding protein 3-like 1, mRNA
NCBI Official Synonym Full Names
cAMP responsive element binding protein 3 like 1
NCBI Official Symbol
CREB3L1
NCBI Official Synonym Symbols
OASIS
NCBI Protein Information
cyclic AMP-responsive element-binding protein 3-like protein 1
UniProt Protein Name
Cyclic AMP-responsive element-binding protein 3-like protein 1
UniProt Gene Name
CREB3L1
UniProt Synonym Gene Names
OASIS; cAMP-responsive element-binding protein 3-like protein 1; OASIS
UniProt Entry Name
CR3L1_HUMAN

NCBI Description

The protein encoded by this gene is normally found in the membrane of the endoplasmic reticulum (ER). However, upon stress to the ER, the encoded protein is cleaved and the released cytoplasmic transcription factor domain translocates to the nucleus. There it activates the transcription of target genes by binding to box-B elements. [provided by RefSeq, Jun 2013]

Uniprot Description

CREB3L1: Transcription factor that acts during endoplasmic reticulum stress by activating unfolded protein response target genes. Specifically involved in ER-stress response in astrocytes in the central nervous system (By similartity). May play a role in gliosis. In vitro, binds to box-B element, cAMP response element (CRE) and CRE-like sequences, and activates transcription through box-B element but not through CRE. Belongs to the bZIP family. ATF subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription factor; Membrane protein, integral

Chromosomal Location of Human Ortholog: 11p11.2

Cellular Component: endoplasmic reticulum; nucleus

Molecular Function: chromatin binding; protein binding

Biological Process: osteoblast differentiation; unfolded protein response

Research Articles on CREB3L1

Similar Products

Product Notes

The CREB3L1 creb3l1 (Catalog #AAA1271263) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgccg tcttggaacc cttcccggcc gacaggctgt tccccggatc cagcttcctg gacttggggg atctgaacga gtcggacttc ctcaacaatg cgcactttcc tgagcacctg gaccacttta cggagaacat ggaggacttc tccaatgacc tgttcagcag cttctttgat gaccctgtgc tggatgagaa gagccctcta ttggacatgg aactggactc ccctacgcca ggcatccagg cggagcacag ctactccctg agcggcgact cagcgcccca gagccccctt gtgcccatca agatggagga caccacccaa gatgcagagc atggagcatg ggcgctggga cacaaactgt gctccatcat ggtgaagcag gagcagagcc cggagctgcc cgtggaccct ctggctgccc cctcggccat ggctgccgcg gccgccatgg ccaccacccc gctgctgggc ctcagcccct tgtccaggct gcccatcccc caccaggccc cgggagagat gactcagctg ccagtgatca aagcagagcc tctggaggtg aaccagttcc tcaaagtgac accggaggac ctggtgcaga tgcctccgac gccccccagc agccatggca gtgacagcga cggctcccag agtccccgct ctctgccccc ctccagccct gtcaggccca tggcgcgctc ctccacggcc atctccacct ccccactcct cactgcccct cacaaattac aggggacatc agggccactg ctcctgacag aggaggagaa gcggaccctg attgctgagg gctaccccat ccccacaaaa ctccccctca ccaaagccga ggagaaggcc ttgaagagag tccggaggaa aatcaagaac aagatctcag cccaggagag ccgtcgtaag aagaaggagt atgtggagtg tctagaaaag aaggtggaga catttacatc tgagaacaat gaactgtgga agaaggtgga gaccctggag aatgccaaca ggaccctgct ccagcagctg cagaaactcc agactctggt caccaacaag atctccagac cttacaagat ggccgccacc cagactggga cctgcctcat ggtggcagcc ttgtgctttg ttctggtgct gggctccctc gtgccctgcc ttcccgagtt ctcctccggc tcccagactg tgaaggaaga ccccctggcc gcagacggcg tctacacggc cagccagatg ccctcccgaa gcctcctatt ctacgatgac ggggcaggct tatgggaaga tggccgcagc accctgctgc ccatggagcc cccagatggc tgggaaatca accccggggg gccggcagag cagcggcccc gggaccacct gcagcatgat cacctggaca gcacccacga gaccaccaag tacctgagtg aggcctggcc taaagacggt ggaaacggca ccagccccga cttctcccac tccaaggagt ggttccacga cagggatctg ggccccaaca ccaccatcaa actctcctag. It is sometimes possible for the material contained within the vial of "CREB3L1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.