Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UBE2S cdna clone

UBE2S cDNA Clone

Gene Names
UBE2S; EPF5; E2EPF; E2-EPF
Synonyms
UBE2S; UBE2S cDNA Clone; UBE2S cdna clone
Ordering
For Research Use Only!
Sequence
atgaactccaacgtggagaacctacccccgcacatcatccgcctggtgtacaaggaggtgacgacactgaccgcagacccacccgatggcatcaaggtctttcccaacgaggaggacctcaccgacctccaggtcaccatcgagggccctgaggggaccccatatgctggaggtctgttccgcatgaaactcctgctggggaaggacttccctgcctccccccccaagggctacttcctgaccaagatcttccacccgaacgtgggcgccaatggcgagatctgcgtcaacgtgctcaagagggactggacggctgagctgggcatccgacacgtactgctgaccatcaagtgcctgctgatccaccctaaccccgagtctgcactcaacgaggaggcgggccgcctgctcttggagaactacgaggagtatgcagctcgggcccgtctgctcacagagatccacgggggcgccggcgggcccagcggcagggccgaagccggtcgggccctggccagtggcactgaagcttcctccaccgaccctggggccccagggggcccgggaggggctgagggtcccatggccaagaagcatgctggcgagcgcgataagaagctggcggccaagaaaaagacggacaagaagcgggcgctgcggcggctgtag
Sequence Length
669
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,845 Da
NCBI Official Full Name
Homo sapiens ubiquitin-conjugating enzyme E2S, mRNA
NCBI Official Synonym Full Names
ubiquitin conjugating enzyme E2 S
NCBI Official Symbol
UBE2S
NCBI Official Synonym Symbols
EPF5; E2EPF; E2-EPF
NCBI Protein Information
ubiquitin-conjugating enzyme E2 S
UniProt Protein Name
Ubiquitin-conjugating enzyme E2 S
UniProt Gene Name
UBE2S
UniProt Synonym Gene Names
E2EPF
UniProt Entry Name
UBE2S_HUMAN

NCBI Description

This gene encodes a member of the ubiquitin-conjugating enzyme family. The encoded protein is able to form a thiol ester linkage with ubiquitin in a ubiquitin activating enzyme-dependent manner, a characteristic property of ubiquitin carrier proteins. [provided by RefSeq, Jul 2008]

Uniprot Description

UBE2S: Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. Catalyzes 'Lys-11'-linked polyubiquitination. Acts as an essential factor of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated ubiquitin ligase that controls progression through mitosis. Acts by specifically elongating 'Lys-11'-linked polyubiquitin chains initiated by the E2 enzyme UBE2C/UBCH10 on APC/C substrates, enhancing the degradation of APC/C substrates by the proteasome and promoting mitotic exit. Also acts by elongating ubiquitin chains initiated by the E2 enzyme UBE2D1/UBCH5 in vitro; it is however unclear whether UBE2D1/UBCH5 acts as a E2 enzyme for the APC/C in vivo. Also involved in ubiquitination and subsequent degradation of VHL, resulting in an accumulation of HIF1A. In vitro able to promote polyubiquitination using all 7 ubiquitin Lys residues, except 'Lys-48'-linked polyubiquitination. Component of the APC/C complex. Interacts with CDC20, FZR1/CDH1 and VHL. Belongs to the ubiquitin-conjugating enzyme family.

Protein type: EC 6.3.2.19; Ubiquitin conjugating system; Ligase; Ubiquitin ligase

Chromosomal Location of Human Ortholog: 19q13.43

Cellular Component: anaphase-promoting complex; cytoplasm

Molecular Function: ubiquitin protein ligase binding; ubiquitin-protein ligase activity

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; exit from mitosis; protein modification process

Research Articles on UBE2S

Similar Products

Product Notes

The UBE2S ube2s (Catalog #AAA1271193) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaactcca acgtggagaa cctacccccg cacatcatcc gcctggtgta caaggaggtg acgacactga ccgcagaccc acccgatggc atcaaggtct ttcccaacga ggaggacctc accgacctcc aggtcaccat cgagggccct gaggggaccc catatgctgg aggtctgttc cgcatgaaac tcctgctggg gaaggacttc cctgcctccc cccccaaggg ctacttcctg accaagatct tccacccgaa cgtgggcgcc aatggcgaga tctgcgtcaa cgtgctcaag agggactgga cggctgagct gggcatccga cacgtactgc tgaccatcaa gtgcctgctg atccacccta accccgagtc tgcactcaac gaggaggcgg gccgcctgct cttggagaac tacgaggagt atgcagctcg ggcccgtctg ctcacagaga tccacggggg cgccggcggg cccagcggca gggccgaagc cggtcgggcc ctggccagtg gcactgaagc ttcctccacc gaccctgggg ccccaggggg cccgggaggg gctgagggtc ccatggccaa gaagcatgct ggcgagcgcg ataagaagct ggcggccaag aaaaagacgg acaagaagcg ggcgctgcgg cggctgtag. It is sometimes possible for the material contained within the vial of "UBE2S, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.