APBA3 cdna clone
APBA3 cDNA Clone
Gene Names
APBA3; X11L2; mint3; MGC:15815
Synonyms
APBA3; APBA3 cDNA Clone; APBA3 cdna clone
Sequence
atggcccaggcccgggaggccatggaccgcgtcaaggcccccgatggggagacccagcccatgacggaggtggacctgttcgtctccaccaagaggatcaaggtcttgacagcggactcccaggaggccatgatggaccacgccctgcataccatctcctacacagccgacatcggctgcgtgctggtgctgatggcgcggcggcggctggcacggaggccggcaccccaggaccacggccgccgcctctacaagatgctctgccacgtattctacgcagaggacgcccagctcatcgcccaggccattggccaggccttcgccgccgcctacagccagttcctacgggaaagcggtattgaccccagccaggtgggcgtgcacccgagcccaggcgcccgccacctccataatggggacctggaccacttctccaacagtgacaactgccgggaggtgcacctcgagaagcggcgaggggagggcctgggcgtggccctggtggagtcgggctggggctccctgctgcccacagccgtcatcgccaacctgctgcacggggggcctgctgagcgctcgggggccctcagcatcggggaccgcctgaccgccatcaacgggaccagcctggtggggctgcccctggctgcgtgccaggccgctgtccgcgagacgaagtcgcagacgtcggtgacactcagcatcgtccactgccctcccgtcaccaccgccatcatccaccggccccacgcccgcgagcagctgggcttctgcgtggaggacggcatcatctgcagcctcctccgtggtggcatcgccgagcgtgggggcatccgcgtcggccaccgcatcattgagatcaatgggcagagtgtggtggccacgccacacgcccgcatcatcgagctgctcaccgaggcctatggcgaggtgcatatcaagacgatgccagctgccacatatcgcctccttacaggccaggagcagcccgtgtacctgtga
Sequence Length
1002
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
61,454 Da
NCBI Official Full Name
Homo sapiens amyloid beta (A4) protein-binding, family A, member 3, mRNA
NCBI Official Synonym Full Names
amyloid beta precursor protein binding family A member 3
NCBI Official Symbol
APBA3
NCBI Official Synonym Symbols
X11L2; mint3; MGC:15815
NCBI Protein Information
amyloid beta A4 precursor protein-binding family A member 3
UniProt Protein Name
Amyloid beta A4 precursor protein-binding family A member 3
Protein Family
UniProt Gene Name
APBA3
UniProt Synonym Gene Names
MINT3; X11L2; Mint-3
UniProt Entry Name
APBA3_HUMAN
NCBI Description
The protein encoded by this gene is a member of the X11 protein family. It is an adapter protein that interacts with the Alzheimer's disease amyloid precursor protein. This gene product is believed to be involved in signal transduction processes. This gene is a candidate gene for Alzheimer's disease. [provided by RefSeq, Jul 2008]
Uniprot Description
APBA3: May modulate processing of the beta-amyloid precursor protein (APP) and hence formation of beta-APP. May enhance the activity of HIF1A in macrophages by inhibiting the activity of HIF1AN.
Protein type: Motility/polarity/chemotaxis
Chromosomal Location of Human Ortholog: 19p13.3
Cellular Component: perinuclear region of cytoplasm
Molecular Function: enzyme binding; enzyme inhibitor activity; protein binding
Biological Process: negative regulation of catalytic activity
Research Articles on APBA3
Similar Products
Product Notes
The APBA3 apba3 (Catalog #AAA1271183) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccagg cccgggaggc catggaccgc gtcaaggccc ccgatgggga gacccagccc atgacggagg tggacctgtt cgtctccacc aagaggatca aggtcttgac agcggactcc caggaggcca tgatggacca cgccctgcat accatctcct acacagccga catcggctgc gtgctggtgc tgatggcgcg gcggcggctg gcacggaggc cggcacccca ggaccacggc cgccgcctct acaagatgct ctgccacgta ttctacgcag aggacgccca gctcatcgcc caggccattg gccaggcctt cgccgccgcc tacagccagt tcctacggga aagcggtatt gaccccagcc aggtgggcgt gcacccgagc ccaggcgccc gccacctcca taatggggac ctggaccact tctccaacag tgacaactgc cgggaggtgc acctcgagaa gcggcgaggg gagggcctgg gcgtggccct ggtggagtcg ggctggggct ccctgctgcc cacagccgtc atcgccaacc tgctgcacgg ggggcctgct gagcgctcgg gggccctcag catcggggac cgcctgaccg ccatcaacgg gaccagcctg gtggggctgc ccctggctgc gtgccaggcc gctgtccgcg agacgaagtc gcagacgtcg gtgacactca gcatcgtcca ctgccctccc gtcaccaccg ccatcatcca ccggccccac gcccgcgagc agctgggctt ctgcgtggag gacggcatca tctgcagcct cctccgtggt ggcatcgccg agcgtggggg catccgcgtc ggccaccgca tcattgagat caatgggcag agtgtggtgg ccacgccaca cgcccgcatc atcgagctgc tcaccgaggc ctatggcgag gtgcatatca agacgatgcc agctgccaca tatcgcctcc ttacaggcca ggagcagccc gtgtacctgt ga. It is sometimes possible for the material contained within the vial of "APBA3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
