Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UCK1 cdna clone

UCK1 cDNA Clone

Gene Names
UCK1; URK1
Synonyms
UCK1; UCK1 cDNA Clone; UCK1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcttcggcgggaggcgaagactgcgagagccccgcgccggaggccgaccgtccgcaccagcggcccttcctgataggggtgagcggcggcactgccagcgggaagtcgaccgtgtgtgagaagatcatggagttgctgggacagaacgaggtggaacagcggcagcggaaggtggtcatcctgagccaggacaggttctacaaggtcctgacggcagagcagaaggccaaggccttgaaaggacagtacaattttgaccatccagatgcctttgataatgatttgatgcacaggactctgaagaacatcgtggagggcaaaacggtggaggtgccgacctatgattttgtgacacactcaaggttaccagagaccacggtggtctaccctgcggacgtggttctgtttgagggcatcttggtgttctacagccaggagatccgggacatgttccacctgcgcctcttcgtggacaccgactccgacgtcaggctgtctcgaagagacaaagaagtatgccgatgtgatcatcccacgaggagtggacaatatggttgccatcaacctgatcgtgcagcacatccaggacattctgaatggtga
Sequence Length
606
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,275 Da
NCBI Official Full Name
Homo sapiens uridine-cytidine kinase 1, mRNA
NCBI Official Synonym Full Names
uridine-cytidine kinase 1
NCBI Official Symbol
UCK1
NCBI Official Synonym Symbols
URK1
NCBI Protein Information
uridine-cytidine kinase 1
UniProt Protein Name
Uridine-cytidine kinase 1
Protein Family
UniProt Gene Name
UCK1
UniProt Synonym Gene Names
URK1; UCK 1
UniProt Entry Name
UCK1_HUMAN

NCBI Description

This gene encodes a uridine-cytidine kinase that catalyzes the phosphorylation of uridine and cytidine to uridine monophosphate (UMP) and cytidine monophosphate (CMP) but not the phosphorylation of deoxyribonucleosides or purine ribonucleosides. This enzyme can also phosphorylate uridine and cytidine analogs and uses both ATP and GTP as a phosphate donor. Alternative splicing results in multiple splice variants encoding distinct isoforms. [provided by RefSeq, May 2012]

Uniprot Description

UCK1: Phosphorylates uridine and cytidine to uridine monophosphate and cytidine monophosphate. Does not phosphorylate deoxyribonucleosides or purine ribonucleosides. Can use ATP or GTP as a phosphate donor. Can also phosphorylate cytidine and uridine nucleoside analogs such as 6-azauridine, 5-fluorouridine, 4- thiouridine, 5-bromouridine, N(4)-acetylcytidine, N(4)- benzoylcytidine, 5-fluorocytidine, 2-thiocytidine, 5- methylcytidine, and N(4)-anisoylcytidine. Belongs to the uridine kinase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 2.7.1.48; Kinase, other; Nucleotide Metabolism - pyrimidine; Xenobiotic Metabolism - drug metabolism - other enzymes

Chromosomal Location of Human Ortholog: 9q34.13

Cellular Component: cytosol

Molecular Function: nucleoside kinase activity; uridine kinase activity

Biological Process: pyrimidine base metabolic process; pyrimidine nucleoside salvage

Research Articles on UCK1

Similar Products

Product Notes

The UCK1 uck1 (Catalog #AAA1271156) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttcgg cgggaggcga agactgcgag agccccgcgc cggaggccga ccgtccgcac cagcggccct tcctgatagg ggtgagcggc ggcactgcca gcgggaagtc gaccgtgtgt gagaagatca tggagttgct gggacagaac gaggtggaac agcggcagcg gaaggtggtc atcctgagcc aggacaggtt ctacaaggtc ctgacggcag agcagaaggc caaggccttg aaaggacagt acaattttga ccatccagat gcctttgata atgatttgat gcacaggact ctgaagaaca tcgtggaggg caaaacggtg gaggtgccga cctatgattt tgtgacacac tcaaggttac cagagaccac ggtggtctac cctgcggacg tggttctgtt tgagggcatc ttggtgttct acagccagga gatccgggac atgttccacc tgcgcctctt cgtggacacc gactccgacg tcaggctgtc tcgaagagac aaagaagtat gccgatgtga tcatcccacg aggagtggac aatatggttg ccatcaacct gatcgtgcag cacatccagg acattctgaa tggtga. It is sometimes possible for the material contained within the vial of "UCK1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.