NFIA cdna clone
NFIA cDNA Clone
Gene Names
NFIA; CTF; NF1-A; NFI-A; NFI-L; NF-I/A
Synonyms
NFIA; NFIA cDNA Clone; NFIA cdna clone
Sequence
atgtattctccgctctgtctcacccaggatgaatttcatcctttcatcgaagcacttctgccccacgtccgagcctttgcctacacatggttcaacctgcaggcccgaaaacgaaaatacttcaaaaaacatgaaaagcgtatgtcaaaagaagaagagagagccgtgaaggatgaattgctaagtgaaaaaccagaggtcaagcagaagtgggcatctcgacttctggcaaagttgcggaaagatatccgacccgaatatcgagaggattttgttcttacagttacagggaaaaaacctccatgttgtgttctttccaacccagaccagaaaggcaagatgcgaagaattgactgcctccgccaggcagataaagtctggaggttggaccttgttatggtgattttgtttaaaggtattccgctggaaagtactgatggcgagcgccttgtaaagtccccacaatgctctaatccagggctctgtgtccaaccccatcacataggggtttctgttaaggaactcgatttatatttggcatactttgtgcatgcagcagattcaagtcaatctgaaagtcccagccagccaagtgacgctgacattaaggaccagccagaaaatggacatttgggcttccaggacagttttgtcacatcaggtgtttttagtgtcactgagctagtaagagtgtcacagacaccaatagctgcaggaactggcccaaatttttctctctcagatttggaaagttcttcatactacagcatgagtccaggagcaatgaggaggtctttacccagcacatcctctacgagctccacaaagcgcctcaagtctgtggaggatgaaatggacagtcctggtgaggagccattttatacaggccaagggcgctccccaggaagtggcagtcagtcaagtggatggcatgaagtggagccaggaatgccatctccaaccacactgaagaagtcggagaagtctggtttcagcagcccctccccttcacagacctcctccctgggaacggcgttcacacagcatcaccgacctgtcattacaggacccagagcaagtccgcatgcaacaccatcgactcttcatttcccgacatcacccattatccagcagcctgggccttacttctcacacccagccatccgctatcaccctcaggagacgctgaaagaatttgtccaacttgtctgccctgatgctggtcagcaggctggacaggtggggttcctcaatcccaatgggagcagccaaggcaaggtgcacaacccattccttcccaccccaatgttgccaccgccaccgccaccaccgatggccaggcctgtgcctctgccggtgccagacacaaagcctccaaccacgtcaacagaaggaggtgcagcctcccccacgtcaccaatcctggtacctgggataaaagttgcagcgtcccaccatccaccagacagaccacctgaccccttctcaactctgtaa
Sequence Length
1497
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
60,894 Da
NCBI Official Full Name
Homo sapiens nuclear factor I/A, mRNA
NCBI Official Synonym Full Names
nuclear factor I A
NCBI Official Symbol
NFIA
NCBI Official Synonym Symbols
CTF; NF1-A; NFI-A; NFI-L; NF-I/A
NCBI Protein Information
nuclear factor 1 A-type
UniProt Protein Name
Nuclear factor 1 A-type
Protein Family
UniProt Gene Name
NFIA
UniProt Synonym Gene Names
KIAA1439; NF1-A; Nuclear factor 1/A; CTF; NF-I/A; NFI-A
UniProt Entry Name
NFIA_HUMAN
NCBI Description
This gene encodes a member of the NF1 (nuclear factor 1) family of transcription factors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Uniprot Description
NFI-A: Recognizes and binds the palindromic sequence 5'- TTGGCNNNNNGCCAA-3' present in viral and cellular promoters and in the origin of replication of adenovirus type 2. These proteins are individually capable of activating transcription and replication. Belongs to the CTF/NF-I family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: DNA-binding; Transcription factor
Chromosomal Location of Human Ortholog: 1p31.3-p31.2
Cellular Component: cell junction; nucleoplasm; nucleus
Molecular Function: transcription factor binding
Biological Process: negative regulation of transcription from RNA polymerase II promoter; positive regulation of transcription from RNA polymerase II promoter
Research Articles on NFIA
Similar Products
Product Notes
The NFIA nfia (Catalog #AAA1271144) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtattctc cgctctgtct cacccaggat gaatttcatc ctttcatcga agcacttctg ccccacgtcc gagcctttgc ctacacatgg ttcaacctgc aggcccgaaa acgaaaatac ttcaaaaaac atgaaaagcg tatgtcaaaa gaagaagaga gagccgtgaa ggatgaattg ctaagtgaaa aaccagaggt caagcagaag tgggcatctc gacttctggc aaagttgcgg aaagatatcc gacccgaata tcgagaggat tttgttctta cagttacagg gaaaaaacct ccatgttgtg ttctttccaa cccagaccag aaaggcaaga tgcgaagaat tgactgcctc cgccaggcag ataaagtctg gaggttggac cttgttatgg tgattttgtt taaaggtatt ccgctggaaa gtactgatgg cgagcgcctt gtaaagtccc cacaatgctc taatccaggg ctctgtgtcc aaccccatca cataggggtt tctgttaagg aactcgattt atatttggca tactttgtgc atgcagcaga ttcaagtcaa tctgaaagtc ccagccagcc aagtgacgct gacattaagg accagccaga aaatggacat ttgggcttcc aggacagttt tgtcacatca ggtgttttta gtgtcactga gctagtaaga gtgtcacaga caccaatagc tgcaggaact ggcccaaatt tttctctctc agatttggaa agttcttcat actacagcat gagtccagga gcaatgagga ggtctttacc cagcacatcc tctacgagct ccacaaagcg cctcaagtct gtggaggatg aaatggacag tcctggtgag gagccatttt atacaggcca agggcgctcc ccaggaagtg gcagtcagtc aagtggatgg catgaagtgg agccaggaat gccatctcca accacactga agaagtcgga gaagtctggt ttcagcagcc cctccccttc acagacctcc tccctgggaa cggcgttcac acagcatcac cgacctgtca ttacaggacc cagagcaagt ccgcatgcaa caccatcgac tcttcatttc ccgacatcac ccattatcca gcagcctggg ccttacttct cacacccagc catccgctat caccctcagg agacgctgaa agaatttgtc caacttgtct gccctgatgc tggtcagcag gctggacagg tggggttcct caatcccaat gggagcagcc aaggcaaggt gcacaaccca ttccttccca ccccaatgtt gccaccgcca ccgccaccac cgatggccag gcctgtgcct ctgccggtgc cagacacaaa gcctccaacc acgtcaacag aaggaggtgc agcctccccc acgtcaccaa tcctggtacc tgggataaaa gttgcagcgt cccaccatcc accagacaga ccacctgacc ccttctcaac tctgtaa. It is sometimes possible for the material contained within the vial of "NFIA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
