Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TTC8 cdna clone

TTC8 cDNA Clone

Gene Names
TTC8; BBS8; RP51
Synonyms
TTC8; TTC8 cDNA Clone; TTC8 cdna clone
Ordering
For Research Use Only!
Sequence
atgagctcggagatggagccgctgctcctggcctggagctattttaggcgcaggaagttccagctctgcgccgatctatgcacgcagatgctggagaagtccccttatgaccaggcagcttggatcttaaaagcaagagcgctaacagaaatggtatacatagatgaaattgatgtagatcaggaaggaattgcagaaatgatgctggatgaaaatgctatagctcaagttccacgccctggaacgtctttgaaactccctggaactaatcagacaggagggcctagccaggccgttaggccaatcacacaagctggaagacccattacaggtttcctcaggcccagcacgcagagtggaaggccaggcactatggaacaggctatcagaacacccagaaccgcctacacagcccgccctatcaccagctcctccggaagatttgtcaggctgggaacggcttccatgcttacaagtcctgatggaccatttataaatttatctaggctgaatttaacaaagtattcccagaaacctaagttggcaaaggctttgtttgagtatatctttcatcatgaaaatgatgttaagactattcatcttgaagatgtagttctacatcttggaatttacccattcttattgaggaataaaaatcacattgaaaaaaatgctttggatctggctgccctctccacagaacattctcagtacaaggactggtggtggaaagtacagattggaaaatgttactacaggttgggaatgtatcgtgaagcagaaaaacagtttaaatcagccctgaagcagcaggaaatggtagatacatttctgtacttggcaaaagtttatgtctcattggatcaacctgtgactgctttaaatcttttcaaacaaggcttagataagtttccaggagaagtaaccctgctctgtggaattgcaagaatctatgaggaaatgaacaatatgtcatcagcagcagaatattacaaagaagttttgaaacaagacaatactcatgtggaagccatcgcatgcattggaagcaaccacttctattctgatcagccagaaatagctctccggttttacaggcggctgctgcagatgggcatttataacggccagctttttaacaatctggggctgtgttgcttctatgcccagcagtatgatatgactctgacctcatttgaacgtgccctttctttggctgaaaatgaagaagaggcagctgatgtctggtacaacttgggacatgtagctgtgggaataggagatacaaatttggcccatcagtgcttcaggctggctctggtcaacaacaacaaccacgccgaggcctacaacaacctggctgtgctggagatgcggaagggccacgttgaacaggcaagggcactattacaaactgcatcatcattagcaccccatatgtatgaaccgcattttaattttgcaacaatctctgataagattggagatctgcagagaagctatgttgctgcgcagaagtctgaagcagcatttccagaccatgtggacacacaacatttaattaaacaattaaggcagcattttgctatgctctga
Sequence Length
1596
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,712 Da
NCBI Official Full Name
Homo sapiens tetratricopeptide repeat domain 8, mRNA
NCBI Official Synonym Full Names
tetratricopeptide repeat domain 8
NCBI Official Symbol
TTC8
NCBI Official Synonym Symbols
BBS8; RP51
NCBI Protein Information
tetratricopeptide repeat protein 8
UniProt Protein Name
Tetratricopeptide repeat protein 8
UniProt Gene Name
TTC8
UniProt Synonym Gene Names
BBS8; TPR repeat protein 8
UniProt Entry Name
TTC8_HUMAN

NCBI Description

This gene encodes a protein that has been directly linked to Bardet-Biedl syndrome. The primary features of this syndrome include retinal dystrophy, obesity, polydactyly, renal abnormalities and learning disabilities. Experimentation in non-human eukaryotes suggests that this gene is expressed in ciliated cells and that it is involved in the formation of cilia. A mutation in this gene has also been implicated in nonsyndromic retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Uniprot Description

TTC8: The BBSome complex is required for ciliogenesis but is dispensable for centriolar satellite function. This ciliogenic function is mediated in part by the Rab8 GDP/GTP exchange factor, which localizes to the basal body and contacts the BBSome. Rab8(GTP) enters the primary cilium and promotes extension of the ciliary membrane. Firstly the BBSome associates with the ciliary membrane and binds to RAB3IP/Rabin8, the guanosyl exchange factor (GEF) for Rab8 and then the Rab8-GTP localizes to the cilium and promotes docking and fusion of carrier vesicles to the base of the ciliary membrane. Defects in TTC8 are the cause of retinitis pigmentosa type 51 (RP51). It is a retinal dystrophy belonging to the group of pigmentary retinopathies. Retinitis pigmentosa is characterized by retinal pigment deposits visible on fundus examination and primary loss of rod photoreceptor cells followed by secondary loss of cone photoreceptors. Patients typically have night vision blindness and loss of midperipheral visual field. As their condition progresses, they lose their far peripheral visual field and eventually central vision as well. Defects in TTC8 are the cause of Bardet-Biedl syndrome type 8 (BBS8). Bardet-Biedl syndrome (BBS) is a genetically heterogeneous, autosomal recessive disorder characterized by usually severe pigmentary retinopathy, early onset obesity, polydactyly, hypogenitalism, renal malformation and mental retardation. Secondary features include diabetes mellitus, hypertension and congenital heart disease. A relatively high incidence of BBS is found in the mixed Arab populations of Kuwait and in Bedouin tribes throughout the Middle East, most likely due to the high rate of consaguinity in these populations and a founder effect. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Cytoskeletal

Chromosomal Location of Human Ortholog: 14q31.3

Cellular Component: centrosome; cilium; cytosol

Molecular Function: protein binding

Biological Process: cilium biogenesis; establishment of anatomical structure orientation; sensory processing

Disease: Bardet-biedl Syndrome 8; Retinitis Pigmentosa 51

Research Articles on TTC8

Similar Products

Product Notes

The TTC8 ttc8 (Catalog #AAA1271130) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagctcgg agatggagcc gctgctcctg gcctggagct attttaggcg caggaagttc cagctctgcg ccgatctatg cacgcagatg ctggagaagt ccccttatga ccaggcagct tggatcttaa aagcaagagc gctaacagaa atggtataca tagatgaaat tgatgtagat caggaaggaa ttgcagaaat gatgctggat gaaaatgcta tagctcaagt tccacgccct ggaacgtctt tgaaactccc tggaactaat cagacaggag ggcctagcca ggccgttagg ccaatcacac aagctggaag acccattaca ggtttcctca ggcccagcac gcagagtgga aggccaggca ctatggaaca ggctatcaga acacccagaa ccgcctacac agcccgccct atcaccagct cctccggaag atttgtcagg ctgggaacgg cttccatgct tacaagtcct gatggaccat ttataaattt atctaggctg aatttaacaa agtattccca gaaacctaag ttggcaaagg ctttgtttga gtatatcttt catcatgaaa atgatgttaa gactattcat cttgaagatg tagttctaca tcttggaatt tacccattct tattgaggaa taaaaatcac attgaaaaaa atgctttgga tctggctgcc ctctccacag aacattctca gtacaaggac tggtggtgga aagtacagat tggaaaatgt tactacaggt tgggaatgta tcgtgaagca gaaaaacagt ttaaatcagc cctgaagcag caggaaatgg tagatacatt tctgtacttg gcaaaagttt atgtctcatt ggatcaacct gtgactgctt taaatctttt caaacaaggc ttagataagt ttccaggaga agtaaccctg ctctgtggaa ttgcaagaat ctatgaggaa atgaacaata tgtcatcagc agcagaatat tacaaagaag ttttgaaaca agacaatact catgtggaag ccatcgcatg cattggaagc aaccacttct attctgatca gccagaaata gctctccggt tttacaggcg gctgctgcag atgggcattt ataacggcca gctttttaac aatctggggc tgtgttgctt ctatgcccag cagtatgata tgactctgac ctcatttgaa cgtgcccttt ctttggctga aaatgaagaa gaggcagctg atgtctggta caacttggga catgtagctg tgggaatagg agatacaaat ttggcccatc agtgcttcag gctggctctg gtcaacaaca acaaccacgc cgaggcctac aacaacctgg ctgtgctgga gatgcggaag ggccacgttg aacaggcaag ggcactatta caaactgcat catcattagc accccatatg tatgaaccgc attttaattt tgcaacaatc tctgataaga ttggagatct gcagagaagc tatgttgctg cgcagaagtc tgaagcagca tttccagacc atgtggacac acaacattta attaaacaat taaggcagca ttttgctatg ctctga. It is sometimes possible for the material contained within the vial of "TTC8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.