Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATPAF2 cdna clone

ATPAF2 cDNA Clone

Gene Names
ATPAF2; ATP12; ATP12p; LP3663; MC5DN1
Synonyms
ATPAF2; ATPAF2 cDNA Clone; ATPAF2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtggaggagctgcctccggctgcgggacgggggacgccgtctcctgaatcggccggcgggtggccccagcgcttctatgagtccggggccaaccatcccgtctccagcccgggcttacgccccgccgacagaaaggaagaggttttatcagaatgtcagcatcacacagggtgaaggtggctttgagataaacctggaccacaggaagctgaaaactccccaagccaagctctttaccgtccccagcgaggccctggccattgcagtggctactgagtgggattcccagcaggataccatcaagtactacaccatgcacctgaccacattgtgcaacacatcattggacaacccaacccagagaaacaaggatcagctgatccgggcagccgtgaagtttctggacaccgacaccatctgctacagggtggaggagcccgagacattagtggaacttcaaaggaatgagtgggatccaatcatcgaatgggctgagaaaagatacggcgtggagatcagttcctccaccagcataatgggacccagcatccctgccaaaactcgggaggtgctcgtcagccacctggcatcttacaacacatgggctttacaagggattgagtttgtagctgcccagctcaagtccatggtgctaaccttgggcctgattgacctgcgcctgacagtggagcaggccgtgctgctgtcacgcctggaggaggagtaccagatccagaagtggggcaacattgagtgggcccatgactatgagctgcaggagctgcgggcccgcaccgccgccggcaccctcttcatccatctctgctccgagagcaccacagtcaagcacaagctcctgaaggagtga
Sequence Length
870
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,772 Da
NCBI Official Full Name
Homo sapiens ATP synthase mitochondrial F1 complex assembly factor 2, mRNA
NCBI Official Synonym Full Names
ATP synthase mitochondrial F1 complex assembly factor 2
NCBI Official Symbol
ATPAF2
NCBI Official Synonym Symbols
ATP12; ATP12p; LP3663; MC5DN1
NCBI Protein Information
ATP synthase mitochondrial F1 complex assembly factor 2
UniProt Protein Name
ATP synthase mitochondrial F1 complex assembly factor 2
UniProt Gene Name
ATPAF2
UniProt Synonym Gene Names
ATP12
UniProt Entry Name
ATPF2_HUMAN

NCBI Description

This gene encodes an assembly factor for the F(1) component of the mitochondrial ATP synthase. This protein binds specifically to the F1 alpha subunit and is thought to prevent this subunit from forming nonproductive homooligomers during enzyme assembly. This gene is located within the Smith-Magenis syndrome region on chromosome 17. An alternatively spliced transcript variant has been described, but its biological validity has not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

ATPAF2: May play a role in the assembly of the F1 component of the mitochondrial ATP synthase (ATPase). Defects in ATPAF2 are a cause of mitochondrial complex V deficiency nuclear type 1 (MC5DN1). A mitochondrial disorder with heterogeneous clinical manifestations including dysmorphic features, psychomotor retardation, hypotonia, growth retardation, cardiomyopathy, enlarged liver, hypoplastic kidneys and elevated lactate levels in urine, plasma and cerebrospinal fluid. Belongs to the ATP12 family.

Protein type: Mitochondrial

Chromosomal Location of Human Ortholog: 17p11.2

Cellular Component: cytoplasm; nuclear speck

Molecular Function: protein binding

Disease: Mitochondrial Complex V (atp Synthase) Deficiency, Nuclear Type 1

Research Articles on ATPAF2

Similar Products

Product Notes

The ATPAF2 atpaf2 (Catalog #AAA1270954) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggagga gctgcctccg gctgcgggac gggggacgcc gtctcctgaa tcggccggcg ggtggcccca gcgcttctat gagtccgggg ccaaccatcc cgtctccagc ccgggcttac gccccgccga cagaaaggaa gaggttttat cagaatgtca gcatcacaca gggtgaaggt ggctttgaga taaacctgga ccacaggaag ctgaaaactc cccaagccaa gctctttacc gtccccagcg aggccctggc cattgcagtg gctactgagt gggattccca gcaggatacc atcaagtact acaccatgca cctgaccaca ttgtgcaaca catcattgga caacccaacc cagagaaaca aggatcagct gatccgggca gccgtgaagt ttctggacac cgacaccatc tgctacaggg tggaggagcc cgagacatta gtggaacttc aaaggaatga gtgggatcca atcatcgaat gggctgagaa aagatacggc gtggagatca gttcctccac cagcataatg ggacccagca tccctgccaa aactcgggag gtgctcgtca gccacctggc atcttacaac acatgggctt tacaagggat tgagtttgta gctgcccagc tcaagtccat ggtgctaacc ttgggcctga ttgacctgcg cctgacagtg gagcaggccg tgctgctgtc acgcctggag gaggagtacc agatccagaa gtggggcaac attgagtggg cccatgacta tgagctgcag gagctgcggg cccgcaccgc cgccggcacc ctcttcatcc atctctgctc cgagagcacc acagtcaagc acaagctcct gaaggagtga. It is sometimes possible for the material contained within the vial of "ATPAF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.