Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDX3X cdna clone

DDX3X cDNA Clone

Gene Names
DDX3X; DBX; DDX3; HLP2; DDX14; CAP-Rf; MRX102
Synonyms
DDX3X; DDX3X cDNA Clone; DDX3X cdna clone
Ordering
For Research Use Only!
Sequence
atgagtcatgtggcagtggaaaatgcgctcgggctggaccagcagtttgctggcctagacctgaactcttcagataatcagagtggaggaagtacagccagcaaagggcgctatattcctcctcatttaaggaaccgagaagctactaaaggtttctacgataaagacagttcagggtggagttctagcaaagataaggatgcgtatagcagttttggatctcgtagtgattcaagagggaagtctagcttcttcagtgatcgtggaagtggatcaaggggaaggtttgatgatcgtggacggagtgattacgatggcattggcagccgtggtgacagaagtggctttggcaaatttgaacgtggtggaaacagtcgctggtgtgacaaatcagatgaagatgattggtcaaaaccactcccaccaagtgaacgcttggaacaggaactcttttctggaggcaacactgggattaattttgagaaatacgatgacattccagttgaggcaacaggcaacaactgtcctccacatattgaaagtttcagtgatgttgagatgggagaaattatcatgggaaacattgagcttactcgttatactcgcccaactccagtgcaaaagcatgctattcctattatcaaagagaaaagagacttgatggcttgtgcccaaacagggtctggaaaaactgcagcatttctgttgcccatcttgagtcagatttattcagatggtccaggcgaggctttgagggccatgaaggaaaatggaaggtatgggcgccgcaaacaatacccaatctccttggtattagcaccaacgagagagttggcagtacagatctacgaggaagccagaaaattttcataccgatctagagttcgtccttgcgtggtttatggtggtgccgatattggtcagcagattcgagacttggaacgtggatgccatttgttagtagccactccaggacgtctagtggatatgatggaaagaggaaagattggattagacttttgcaaatacttggtgttagatgaagctgatcggatgttggatatggggtttgagcctcagattcgtagaatagtcgaacaagatactatgcctccaaagggtgtccgccacactatgatgtttagtgctacttttcctaaggaaatacagatgctggctcgtgatttcttagatgaatatatcttcttggctgtaggaagagttggctctacctctgaaaacatcacacagaaagtagtttgggtggaagaatcagacaaacggtcatttctgcttgacctcctaaatgcaacaggcaaggattcactgaccttagtgtttgtggagaccaaaaagggtgcagattctctggaggatttcttataccatgaaggatacgcatgtaccagcatccatggagaccgttctcagagggatagagaagaggcccttcaccagttccgctcaggaaaaagcccaattttagtggctacagcagtagcagcaagaggactggacatttcaaatgtgaaacatgttatcaattttgacttgccaagtgatattgaagaatatgtacatcgtattggtcgtacgggacgtgtaggaaaccttggcctggcaacctcattctttaacgagaggaacataaatattactaaggatttgttggatcttcttgttgaagctaaacaagaagtgccgtcttggttagaaaacatggcttatgaacaccactacaagggtagcagtcgtggacgttctaagagtagcagatttagtggagggtttggtgccagagactaccgacaaagtagcggtgccagcagttccagcttcagcagcagccgcgcaagcagcagccgcagtggcggaggtggccacggtagcagcagaggatttggtggaggtggctatggaggcttttacaacagtgatggatatggaggaaattataactcccagggggttgactggtggggtaactga
Sequence Length
1989
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
71,355 Da
NCBI Official Full Name
Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked, mRNA
NCBI Official Synonym Full Names
DEAD-box helicase 3, X-linked
NCBI Official Symbol
DDX3X
NCBI Official Synonym Symbols
DBX; DDX3; HLP2; DDX14; CAP-Rf; MRX102
NCBI Protein Information
ATP-dependent RNA helicase DDX3X
UniProt Protein Name
ATP-dependent RNA helicase DDX3X
UniProt Gene Name
DDX3X
UniProt Synonym Gene Names
DBX; DDX3; HLP2
UniProt Entry Name
DDX3X_HUMAN

NCBI Description

The protein encoded by this gene is a member of the large DEAD-box protein family, that is defined by the presence of the conserved Asp-Glu-Ala-Asp (DEAD) motif, and has ATP-dependent RNA helicase activity. This protein has been reported to display a high level of RNA-independent ATPase activity, and unlike most DEAD-box helicases, the ATPase activity is thought to be stimulated by both RNA and DNA. This protein has multiple conserved domains and is thought to play roles in both the nucleus and cytoplasm. Nuclear roles include transcriptional regulation, mRNP assembly, pre-mRNA splicing, and mRNA export. In the cytoplasm, this protein is thought to be involved in translation, cellular signaling, and viral replication. Misregulation of this gene has been implicated in tumorigenesis. This gene has a paralog located in the nonrecombining region of the Y chromosome. Pseudogenes sharing similarity to both this gene and the DDX3Y paralog are found on chromosome 4 and the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]

Uniprot Description

DDX3: a multifunctional DEAD box family RNA helicase with diverse cellular functions. DEAD box proteins are characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), and are involved in several steps of gene expression, such as transcription, maturation of nuclear and mitochondrial mRNA, mRNA export, translation initiation, and ribosome and spliceosome assembly. DDX3 is required for nuclear export of HIV-1 viral transcripts, possibly in a complex with the viral Rev protein and host cofactor CRM1. DDX3 is required for hepatitis C virus (HCV) RNA replication and its expression is downregulated in hepatitis B virus (HBV) associated hepatocellular carcinoma (HCC). May function as a tumor suppressor protein. Its expression inhibits tumor cell colony formation and increases expression of the cdk inhibitor p21 Waf1/Cip1. Low DDX3 expression has been shown in HCC, and aberrant subcellular localization occurs in many squamous cell carcinomas. Reduced DDX3 expression in cultured cells causes a diminished dependence on serum for cell proliferation and changes in cyclin D1 and p21 Waf1/Cip1 expression. Associates with eIF4F to promote translation of selected mRNAs. Is phosphorylated by the mitotic cyclin dependent kinase, cyclin B/cdc2. This phosphorylation may cause a loss of DDX3 function and a concomitant repression of ribosome biogenesis and translation in mitosis. Involved in TBK1 and IKBKE-dependent IRF3 activation leading to IFN-beta induction. Involved in regulation of apoptosis. May be required for activation of the intrinsic but inhibit activation of the extrinsic apoptotic pathway. Regulated by the cell cycle. Maximally expressed in the cytoplasm during G1/S phase and decreased expression during G2/M phase. Located predominantly in nuclear speckles and, at low levels, throughout the cytoplasm. Associates with the outer side of nuclear pore complexes (NPC) and mitochondrial outer membranes. Shuttles between the nucleus and the cytoplasm in an exportin1-dependent manner. Associates with polyadenylated mRNAs in the cytoplasm and the nucleus. Predominantly located in nucleus during G0 phase and in the cytoplasm during G1/S phase. Belongs to the DEAD box helicase family, DDX3 subfamily. Two isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.6.4.13; Translation initiation; RNA-binding; Spliceosome; Helicase; Cell cycle regulation

Chromosomal Location of Human Ortholog: Xp11.3-p11.23

Cellular Component: cell-cell adherens junction; cytoplasm; eukaryotic translation initiation factor 3 complex; nucleus; stress granule

Molecular Function: ATP-dependent DNA helicase activity; ATP-dependent RNA helicase activity; ATPase activity; CTPase activity; DNA binding; eukaryotic initiation factor 4E binding; GTPase activity; mRNA 5'-UTR binding; nucleoside-triphosphatase activity; poly(A) binding; protein binding; ribosomal small subunit binding; RNA binding; transcription factor binding; translation initiation factor binding

Biological Process: chromosome segregation; induction of apoptosis via death domain receptors; innate immune response; mature ribosome assembly; negative regulation of apoptosis; negative regulation of caspase activity; negative regulation of cell growth; negative regulation of protein complex assembly; negative regulation of translation; positive regulation of apoptosis; positive regulation of caspase activity; positive regulation of cell growth; positive regulation of interferon-beta production; positive regulation of transcription from RNA polymerase II promoter; positive regulation of translation; positive regulation of translational initiation; positive regulation of viral genome replication; response to virus; RNA secondary structure unwinding; stress granule assembly; Wnt receptor signaling pathway

Disease: Mental Retardation, X-linked 102

Research Articles on DDX3X

Similar Products

Product Notes

The DDX3X ddx3x (Catalog #AAA1270851) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtcatg tggcagtgga aaatgcgctc gggctggacc agcagtttgc tggcctagac ctgaactctt cagataatca gagtggagga agtacagcca gcaaagggcg ctatattcct cctcatttaa ggaaccgaga agctactaaa ggtttctacg ataaagacag ttcagggtgg agttctagca aagataagga tgcgtatagc agttttggat ctcgtagtga ttcaagaggg aagtctagct tcttcagtga tcgtggaagt ggatcaaggg gaaggtttga tgatcgtgga cggagtgatt acgatggcat tggcagccgt ggtgacagaa gtggctttgg caaatttgaa cgtggtggaa acagtcgctg gtgtgacaaa tcagatgaag atgattggtc aaaaccactc ccaccaagtg aacgcttgga acaggaactc ttttctggag gcaacactgg gattaatttt gagaaatacg atgacattcc agttgaggca acaggcaaca actgtcctcc acatattgaa agtttcagtg atgttgagat gggagaaatt atcatgggaa acattgagct tactcgttat actcgcccaa ctccagtgca aaagcatgct attcctatta tcaaagagaa aagagacttg atggcttgtg cccaaacagg gtctggaaaa actgcagcat ttctgttgcc catcttgagt cagatttatt cagatggtcc aggcgaggct ttgagggcca tgaaggaaaa tggaaggtat gggcgccgca aacaataccc aatctccttg gtattagcac caacgagaga gttggcagta cagatctacg aggaagccag aaaattttca taccgatcta gagttcgtcc ttgcgtggtt tatggtggtg ccgatattgg tcagcagatt cgagacttgg aacgtggatg ccatttgtta gtagccactc caggacgtct agtggatatg atggaaagag gaaagattgg attagacttt tgcaaatact tggtgttaga tgaagctgat cggatgttgg atatggggtt tgagcctcag attcgtagaa tagtcgaaca agatactatg cctccaaagg gtgtccgcca cactatgatg tttagtgcta cttttcctaa ggaaatacag atgctggctc gtgatttctt agatgaatat atcttcttgg ctgtaggaag agttggctct acctctgaaa acatcacaca gaaagtagtt tgggtggaag aatcagacaa acggtcattt ctgcttgacc tcctaaatgc aacaggcaag gattcactga ccttagtgtt tgtggagacc aaaaagggtg cagattctct ggaggatttc ttataccatg aaggatacgc atgtaccagc atccatggag accgttctca gagggataga gaagaggccc ttcaccagtt ccgctcagga aaaagcccaa ttttagtggc tacagcagta gcagcaagag gactggacat ttcaaatgtg aaacatgtta tcaattttga cttgccaagt gatattgaag aatatgtaca tcgtattggt cgtacgggac gtgtaggaaa ccttggcctg gcaacctcat tctttaacga gaggaacata aatattacta aggatttgtt ggatcttctt gttgaagcta aacaagaagt gccgtcttgg ttagaaaaca tggcttatga acaccactac aagggtagca gtcgtggacg ttctaagagt agcagattta gtggagggtt tggtgccaga gactaccgac aaagtagcgg tgccagcagt tccagcttca gcagcagccg cgcaagcagc agccgcagtg gcggaggtgg ccacggtagc agcagaggat ttggtggagg tggctatgga ggcttttaca acagtgatgg atatggagga aattataact cccagggggt tgactggtgg ggtaactga. It is sometimes possible for the material contained within the vial of "DDX3X, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.