Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF501 cdna clone

ZNF501 cDNA Clone

Gene Names
ZNF501; ZNF; ZNF52
Synonyms
ZNF501; ZNF501 cDNA Clone; ZNF501 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaacatgggagagttaacatgcagaagaaaccttcaaagtgtagtgaatgtgggaagttctttactcagagatcatctcttacccagcaccagaggattcacagaggagagaagccctatgtgtgcagtgaatgtggaagttgtttccgtaaacagtcaaatcttactcaacatctgagaattcataccggagagaaaccttataaatgtaatgaatgtgagaaagcctttcaaacaaaagcaattcttgttcagcatctgagaattcatactggagagaaaccctataaatgcaatgaatgtggaaaagccttttgtcagagcccatcccttattaaacaccagcgaattcatactggagagaaaccatataaatgtacagaatgtggcaaagccttcagtcagagcatatgccttactcgtcatcagagaagtcattctggagataaaccttttaagtgtaatgaatgtgggaaagcctttaatcagagtgcatgtctcatgcagcatcagagaattcattcaggagagaagccctacacatgcactgaatgtggtaaagccttcactcagaactcttcccttgttgaacatgaaaggactcacactggagagaaactttataagtgtagtgagtgtgaaaaaactttccgcaaacaagcacaccttagtgagcattacagaattcatactggagaaaaaccttatgagtgtgttggatgtgggaaatcctttaggcacagttcagcacttcttcgacatcagaggcttcatgctggagagtaa
Sequence Length
789
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,880 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 501, mRNA
NCBI Official Synonym Full Names
zinc finger protein 501
NCBI Official Symbol
ZNF501
NCBI Official Synonym Symbols
ZNF; ZNF52
NCBI Protein Information
zinc finger protein 501
UniProt Protein Name
Zinc finger protein 501
Protein Family
UniProt Gene Name
ZNF501
UniProt Synonym Gene Names
ZNF52
UniProt Entry Name
ZN501_HUMAN

Uniprot Description

ZNF501: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription regulation; C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 3p21.31

Molecular Function: protein binding; transcription factor activity

Biological Process: regulation of transcription, DNA-dependent

Similar Products

Product Notes

The ZNF501 znf501 (Catalog #AAA1270770) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaacatg ggagagttaa catgcagaag aaaccttcaa agtgtagtga atgtgggaag ttctttactc agagatcatc tcttacccag caccagagga ttcacagagg agagaagccc tatgtgtgca gtgaatgtgg aagttgtttc cgtaaacagt caaatcttac tcaacatctg agaattcata ccggagagaa accttataaa tgtaatgaat gtgagaaagc ctttcaaaca aaagcaattc ttgttcagca tctgagaatt catactggag agaaacccta taaatgcaat gaatgtggaa aagccttttg tcagagccca tcccttatta aacaccagcg aattcatact ggagagaaac catataaatg tacagaatgt ggcaaagcct tcagtcagag catatgcctt actcgtcatc agagaagtca ttctggagat aaacctttta agtgtaatga atgtgggaaa gcctttaatc agagtgcatg tctcatgcag catcagagaa ttcattcagg agagaagccc tacacatgca ctgaatgtgg taaagccttc actcagaact cttcccttgt tgaacatgaa aggactcaca ctggagagaa actttataag tgtagtgagt gtgaaaaaac tttccgcaaa caagcacacc ttagtgagca ttacagaatt catactggag aaaaacctta tgagtgtgtt ggatgtggga aatcctttag gcacagttca gcacttcttc gacatcagag gcttcatgct ggagagtaa. It is sometimes possible for the material contained within the vial of "ZNF501, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.