Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SS18L1 cdna clone

SS18L1 cDNA Clone

Gene Names
SS18L1; CREST; LP2261
Synonyms
SS18L1; SS18L1 cDNA Clone; SS18L1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtccgtggccttcgcgtctgcccggccaagaggcaaaggggaggttacgcagcaaaccatccagaagatgctggacgagaaccaccacctgatccagtgcatcctggagtaccagagcaagggcaagacggccgagtgcacgcagtaccagcagatcctgcaccggaacctggtatacctggccacgatcgcagactccaaccagaacatgcagtccctgcttcctgccccgcccacgcagaacatgaacctgggccctggagccctgactcagagcggctccagccagggcctgcactctcagggcagcctgagtgacgccatcagcacgggcctgccaccctcctccctcctgcagggccagattggcaacgggccgagccacgtgtccatgcagcagacggcgcctaacacgctgcccaccacctccatgagcatctctgggcccggctacagccacgcgggacccgcctcgcagggcgtccccatgcaggggcaaggcaccatcggcaactacgtgtctcggaccaacatcaacatgcagtccaacccagtctccatgatacagcagcaggcggccacgtcgcactacagctcggcgcagggcggcagccagcactaccagggccagtcgtccatcgccatgatggggcagggcagccaggggagcagcatgatggggcagcggcccatggcgccctaccggccctcccagcaaggctcttcccagcagtacctgggccaggaggagtactatggcgagcagtacagccacagccagggcgccgcggagcccatgggccagcagtactaccccgacggccatggcgattacgcctaccagcagtcatcctacacggagcagagctacgaccggtccttcgaggagtccacgcagcactactatgaggggggaaactcccagtacagccagcagcaggccgggtaccagcagggtgccgcgcagcagcagacgtactcccagcagcagtaccccagccagcagagctaccccgggcagcagcagggctacgggtctgcccagggagccccgtcacagtaccccggctaccagcaaggccaaggccagcagtacggaagctaccgagcaccgcagacagcgccgtctgcccagcagcagcggccctacggctatgaacagggccagtatggaaattaccagcagtaa
Sequence Length
1191
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,408 Da
NCBI Official Full Name
Homo sapiens synovial sarcoma translocation gene on chromosome 18-like 1, mRNA
NCBI Official Synonym Full Names
SS18L1, nBAF chromatin remodeling complex subunit
NCBI Official Symbol
SS18L1
NCBI Official Synonym Symbols
CREST; LP2261
NCBI Protein Information
calcium-responsive transactivator
UniProt Protein Name
Calcium-responsive transactivator
UniProt Gene Name
SS18L1
UniProt Synonym Gene Names
CREST; KIAA0693
UniProt Entry Name
CREST_HUMAN

NCBI Description

This gene encodes a calcium-responsive transactivator which is an essential subunit of a neuron-specific chromatin-remodeling complex. The structure of this gene is similar to that of the SS18 gene. Mutations in this gene are involved in amyotrophic lateral sclerosis (ALS). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]

Uniprot Description

SS18L1: Transcriptional activator which is required for calcium- dependent dendritic growth and branching in cortical neurons. Recruits CREB-binding protein (CREBBP) to nuclear bodies. Component of the CREST-BRG1 complex, a multiprotein complex that regulates promoter activation by orchestrating a calcium-dependent release of a repressor complex and a recruitment of an activator complex. In resting neurons, transcription of the c-FOS promoter is inhibited by BRG1-dependent recruitment of a phospho-RB1-HDAC1 repressor complex. Upon calcium influx, RB1 is dephosphorylated by calcineurin, which leads to release of the repressor complex. At the same time, there is increased recruitment of CREBBP to the promoter by a CREST-dependent mechanism, which leads to transcriptional activation. The CREST-BRG1 complex also binds to the NR2B promoter, and activity-dependent induction of NR2B expression involves a release of HDAC1 and recruitment of CREBBP. Belongs to the SS18 family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 20q13.3

Cellular Component: kinetochore; nucleus

Molecular Function: protein binding

Biological Process: positive regulation of transcription, DNA-dependent

Research Articles on SS18L1

Similar Products

Product Notes

The SS18L1 ss18l1 (Catalog #AAA1270753) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccgtgg ccttcgcgtc tgcccggcca agaggcaaag gggaggttac gcagcaaacc atccagaaga tgctggacga gaaccaccac ctgatccagt gcatcctgga gtaccagagc aagggcaaga cggccgagtg cacgcagtac cagcagatcc tgcaccggaa cctggtatac ctggccacga tcgcagactc caaccagaac atgcagtccc tgcttcctgc cccgcccacg cagaacatga acctgggccc tggagccctg actcagagcg gctccagcca gggcctgcac tctcagggca gcctgagtga cgccatcagc acgggcctgc caccctcctc cctcctgcag ggccagattg gcaacgggcc gagccacgtg tccatgcagc agacggcgcc taacacgctg cccaccacct ccatgagcat ctctgggccc ggctacagcc acgcgggacc cgcctcgcag ggcgtcccca tgcaggggca aggcaccatc ggcaactacg tgtctcggac caacatcaac atgcagtcca acccagtctc catgatacag cagcaggcgg ccacgtcgca ctacagctcg gcgcagggcg gcagccagca ctaccagggc cagtcgtcca tcgccatgat ggggcagggc agccagggga gcagcatgat ggggcagcgg cccatggcgc cctaccggcc ctcccagcaa ggctcttccc agcagtacct gggccaggag gagtactatg gcgagcagta cagccacagc cagggcgccg cggagcccat gggccagcag tactaccccg acggccatgg cgattacgcc taccagcagt catcctacac ggagcagagc tacgaccggt ccttcgagga gtccacgcag cactactatg aggggggaaa ctcccagtac agccagcagc aggccgggta ccagcagggt gccgcgcagc agcagacgta ctcccagcag cagtacccca gccagcagag ctaccccggg cagcagcagg gctacgggtc tgcccaggga gccccgtcac agtaccccgg ctaccagcaa ggccaaggcc agcagtacgg aagctaccga gcaccgcaga cagcgccgtc tgcccagcag cagcggccct acggctatga acagggccag tatggaaatt accagcagta a. It is sometimes possible for the material contained within the vial of "SS18L1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.