Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EPHB4 cdna clone

EPHB4 cDNA Clone

Gene Names
EPHB4; HTK; MYK1; TYRO11
Synonyms
EPHB4; EPHB4 cDNA Clone; EPHB4 cdna clone
Ordering
For Research Use Only!
Sequence
atggagctccgggtgctgctctgctgggcttcgttggccgcagctttggaagagaccctgctgaacacaaaattggaaactgctgatctgaagtgggtgacattccctcaggtggacgggcagtgggaggaactgagcggcctggatgaggaacagcacagcgtgcgcacctacgaagtgtgtgacgtgcagcgtgccccgggccaggcccactggcttcgcacaggttgggtcccacggcggggcgccgtccacgtgtacgccacgctgcgcttcaccatgctcgagtgcctgtccctgcctcgggctgggcgctcctgcaaggagaccttcaccgtcttctactatgagagcgatgcggacacggccacggccctcacgccagcctggatggagaacccctacatcaaggtggacacggtggccgcggagcatctcacccggaagcgccctggggccgaggccaccgggaaggtgaatgtcaggacgctgcgtctgggaccgctcagcaaggctggcttctacctggccttccaggaccagggtgcctgcatggccctgctatccctgcacctcttctacaaaaagtgcgcccagctgactgtgaacctgactcgattcccggagactgtgcctcgggagctggttgtgcccgtggccggtagctgcgtggtggatgccgtccccgcccctggccccagccccagcctctactgccgtgaggatggccagtgggccgaacagccggtcacgggctgcagctgtgctccggggttcgaggcagctgaggggaacaccaagtgccgagcctgtgcccagggcaccttcaagcccctgtcaggagaagggtcctgccagccatgcccagccaatagccactctaacaccattggatcagccgtctgccagtgccgcgtcgggtacttccgggcacgcacagacccccggggtgcaccctgcaccacccctccttcggctccgcggagcgtggtttcccgcctgaacggctcctccctgcacctggaatggagtgcccccctggagtctggtggccgagaggacctcacctacgccctccgctgccgggagtgccgacccggaggctcctgtgcgccctgcgggggagacctgacttttgaccccggcccccgggacctggtggagccctgggtggtggttcgagggctacgtcctgacttcacctatacctttgaggtcactgcattgaacggggtatcctccttagccacggggcccgtcccatttgagcctgtcaatgtcaccactgaccgagaggtacctcctgcagtgtccgacatccgggtgacgcggtcctcacccagcagcttgagcctggcctgggctgttccccgggcacccagtggggctgtgctggactacgaggtcaaataccatgagaagggcgccgagggtcccagcagcgtgcggttcctgaagacgtcagaaaaccgggcagagctgcgggggctgaagcggggagccagctacctggtgcaggtacgggcgcgctctgaggccggctacgggcccttcggccaggaacatcacagccagacccaactggatgagagcgagggctggcgggagcagctggccctgattgcgggcacggcagtcgtgggtgtggtcctggtcctggtggtcattgtggtcgcagttctctgcctcaggaagcagagcaatgggagagaagcagaatattcggacaaacacggacagtatctcatcgggcatggtactaaggtctacatcgaccccttcacttatgaagaccctaatgaggctgtgagggaatttgcaaaagagatcgatgtctcctacgtcaagattgaagaggtgattggtgcaggtgagtttggcgaggtgtgccgggggcggctcaaggccccagggaagaaggagagctgtgtggcaatcaagaccctgaagggtggctacacggagcggcagcggcgtgagtttctgagcgaggcctccatcatgggccagttcgagcaccccaatatcatccgcctggagggcgtggtcaccaacagcatgcccgtcatgattctcacagagttcatggagaacggcgccctggactccttcctgcggctaaacgacggacagttcacagtcatccagctcgtgggcatgctgcggggcatcgcctcgggcatgcggtaccttgccgagatgagctacgtccaccgagacctggctgctcgcaacatcctagtcaacagcaacctcgtctgcaaagtgtctgactttggcctttcccgattcctggaggagaactcttccgatcccacctacacgagctccctgggaggaaagattcccatccgatggactgccccggaggccattgccttccggaagttcacttccgccagtgatgcctggagttacgggattgtgatgtgggaggtgatgtcatttggggagaggccgtactgggacatgagcaatcaggacgtgatcaatgccattgaacaggactaccggctgcccccgcccccagactgtcccacctccctccaccagctcatgctggactgttggcagaaagaccggaatgcccggccccgcttcccccaggtggtcagcgccctggacaagatgatccggaaccccgccagcctcaaaatcgtggcccgggagaatggcggggcctcacaccctctcctggaccagcggcagcctcactactcagcttttggctctgtgggcgagtggcttcgggccatcaaaatgggaagatacgaagaaagtttcgcagccgctggctttggctccttcgagctggtcagccagatctctgctgaggacctgctccgaatcggagtcactctggcgggacaccagaagaaaatcttggccagtgtccagcacatgaagtcccaggccaagccgggaaccccgggtgggacaggaggaccggccccgcagtactga
Sequence Length
2964
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,195 Da
NCBI Official Full Name
Homo sapiens EPH receptor B4, mRNA
NCBI Official Synonym Full Names
EPH receptor B4
NCBI Official Symbol
EPHB4
NCBI Official Synonym Symbols
HTK; MYK1; TYRO11
NCBI Protein Information
ephrin type-B receptor 4
UniProt Protein Name
Ephrin type-B receptor 4
Protein Family
UniProt Gene Name
EPHB4
UniProt Synonym Gene Names
HTK; MYK1; TYRO11
UniProt Entry Name
EPHB4_HUMAN

NCBI Description

Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]

Uniprot Description

EphB4: Receptor tyrosine kinase which binds promiscuously transmembrane ephrin-B family ligands residing on adjacent cells, leading to contact-dependent bidirectional signaling into neighboring cells. The signaling pathway downstream of the receptor is referred to as forward signaling while the signaling pathway downstream of the ephrin ligand is referred to as reverse signaling. Together with its cognate ligand/functional ligand EFNB2 plays a central role in heart morphogenesis and angiogenesis through regulation of cell adhesion and cell migration. EPHB4- mediated forward signaling controls cellular repulsion and segregation form EFNB2-expressing cells. Plays also a role in postnatal blood vessel remodeling, morphogenesis and permeability and is thus important in the context of tumor angiogenesis. Belongs to the protein kinase superfamily. Tyr protein kinase family. Ephrin receptor subfamily.

Protein type: Protein kinase, TK; Protein kinase, tyrosine (receptor); Kinase, protein; Membrane protein, integral; EC 2.7.10.1; TK group; Eph family

Chromosomal Location of Human Ortholog: 7q22

Cellular Component: cytosol; extracellular region; integral to plasma membrane; plasma membrane

Molecular Function: ephrin receptor activity; protein binding; transmembrane receptor protein tyrosine kinase activity

Biological Process: angiogenesis; cell adhesion; cell migration during sprouting angiogenesis; ephrin receptor signaling pathway; heart morphogenesis; protein amino acid autophosphorylation

Research Articles on EPHB4

Similar Products

Product Notes

The EPHB4 ephb4 (Catalog #AAA1270720) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagctcc gggtgctgct ctgctgggct tcgttggccg cagctttgga agagaccctg ctgaacacaa aattggaaac tgctgatctg aagtgggtga cattccctca ggtggacggg cagtgggagg aactgagcgg cctggatgag gaacagcaca gcgtgcgcac ctacgaagtg tgtgacgtgc agcgtgcccc gggccaggcc cactggcttc gcacaggttg ggtcccacgg cggggcgccg tccacgtgta cgccacgctg cgcttcacca tgctcgagtg cctgtccctg cctcgggctg ggcgctcctg caaggagacc ttcaccgtct tctactatga gagcgatgcg gacacggcca cggccctcac gccagcctgg atggagaacc cctacatcaa ggtggacacg gtggccgcgg agcatctcac ccggaagcgc cctggggccg aggccaccgg gaaggtgaat gtcaggacgc tgcgtctggg accgctcagc aaggctggct tctacctggc cttccaggac cagggtgcct gcatggccct gctatccctg cacctcttct acaaaaagtg cgcccagctg actgtgaacc tgactcgatt cccggagact gtgcctcggg agctggttgt gcccgtggcc ggtagctgcg tggtggatgc cgtccccgcc cctggcccca gccccagcct ctactgccgt gaggatggcc agtgggccga acagccggtc acgggctgca gctgtgctcc ggggttcgag gcagctgagg ggaacaccaa gtgccgagcc tgtgcccagg gcaccttcaa gcccctgtca ggagaagggt cctgccagcc atgcccagcc aatagccact ctaacaccat tggatcagcc gtctgccagt gccgcgtcgg gtacttccgg gcacgcacag acccccgggg tgcaccctgc accacccctc cttcggctcc gcggagcgtg gtttcccgcc tgaacggctc ctccctgcac ctggaatgga gtgcccccct ggagtctggt ggccgagagg acctcaccta cgccctccgc tgccgggagt gccgacccgg aggctcctgt gcgccctgcg ggggagacct gacttttgac cccggccccc gggacctggt ggagccctgg gtggtggttc gagggctacg tcctgacttc acctatacct ttgaggtcac tgcattgaac ggggtatcct ccttagccac ggggcccgtc ccatttgagc ctgtcaatgt caccactgac cgagaggtac ctcctgcagt gtccgacatc cgggtgacgc ggtcctcacc cagcagcttg agcctggcct gggctgttcc ccgggcaccc agtggggctg tgctggacta cgaggtcaaa taccatgaga agggcgccga gggtcccagc agcgtgcggt tcctgaagac gtcagaaaac cgggcagagc tgcgggggct gaagcgggga gccagctacc tggtgcaggt acgggcgcgc tctgaggccg gctacgggcc cttcggccag gaacatcaca gccagaccca actggatgag agcgagggct ggcgggagca gctggccctg attgcgggca cggcagtcgt gggtgtggtc ctggtcctgg tggtcattgt ggtcgcagtt ctctgcctca ggaagcagag caatgggaga gaagcagaat attcggacaa acacggacag tatctcatcg ggcatggtac taaggtctac atcgacccct tcacttatga agaccctaat gaggctgtga gggaatttgc aaaagagatc gatgtctcct acgtcaagat tgaagaggtg attggtgcag gtgagtttgg cgaggtgtgc cgggggcggc tcaaggcccc agggaagaag gagagctgtg tggcaatcaa gaccctgaag ggtggctaca cggagcggca gcggcgtgag tttctgagcg aggcctccat catgggccag ttcgagcacc ccaatatcat ccgcctggag ggcgtggtca ccaacagcat gcccgtcatg attctcacag agttcatgga gaacggcgcc ctggactcct tcctgcggct aaacgacgga cagttcacag tcatccagct cgtgggcatg ctgcggggca tcgcctcggg catgcggtac cttgccgaga tgagctacgt ccaccgagac ctggctgctc gcaacatcct agtcaacagc aacctcgtct gcaaagtgtc tgactttggc ctttcccgat tcctggagga gaactcttcc gatcccacct acacgagctc cctgggagga aagattccca tccgatggac tgccccggag gccattgcct tccggaagtt cacttccgcc agtgatgcct ggagttacgg gattgtgatg tgggaggtga tgtcatttgg ggagaggccg tactgggaca tgagcaatca ggacgtgatc aatgccattg aacaggacta ccggctgccc ccgcccccag actgtcccac ctccctccac cagctcatgc tggactgttg gcagaaagac cggaatgccc ggccccgctt cccccaggtg gtcagcgccc tggacaagat gatccggaac cccgccagcc tcaaaatcgt ggcccgggag aatggcgggg cctcacaccc tctcctggac cagcggcagc ctcactactc agcttttggc tctgtgggcg agtggcttcg ggccatcaaa atgggaagat acgaagaaag tttcgcagcc gctggctttg gctccttcga gctggtcagc cagatctctg ctgaggacct gctccgaatc ggagtcactc tggcgggaca ccagaagaaa atcttggcca gtgtccagca catgaagtcc caggccaagc cgggaacccc gggtgggaca ggaggaccgg ccccgcagta ctga. It is sometimes possible for the material contained within the vial of "EPHB4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.