Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DEF6 cdna clone

DEF6 cDNA Clone

Gene Names
DEF6; IBP; SLAT; SWAP70L
Synonyms
DEF6; DEF6 cDNA Clone; DEF6 cdna clone
Ordering
For Research Use Only!
Sequence
atggccctgcgcaaggaactgctcaagtccatctggtacgcctttaccgcgctggacgtggagaagagtggcaaagtctccaagtcccagctcaaggtgctgtcccacaacctgtacacggtcctgcacatcccccatgaccccgtggccctggaggaacacttccgagatgatgatgacggccctgtgtccagccagggatacatgccctacctcaacaagtacatcctggacaaggtggaggagggggcttttgttaaagagcactttgatgagctgtgctggacgctgacggccaagaagaactatcgggcagatagcaacgggaacagtatgctctccaatcaggatgccttccgcctctggtgcctcttcaacttcctgtctgaggacaagtaccctctgatcatggttcctgatgaggtggaatacctgctgaaaaaggtactcagcagcatgagcttggaggtgagcttgggtgagctggaggagcttctggcccaggaggcccaggtggcccagaccaccggggggctcagcgtctggcagttcctggagctcttcaattcgggccgctgcctgcggggcgtgggccgggacaccctcagcatggccatccacgaggtctaccaggagctcatccaagatgtcctgaagcagggctacctgtggaagcgagggcacctgagaaggaactgggccgaacgctggttccagctgcagcccagctgcctctgctactttgggagtgaagagtgcaaagagaaaaggggcattatcccgctggatgcacactgctgcgtggaggtgctgccagaccgcgacggaaagcgctgcatgttctgtgtgaagacagccacccgcacgtatgagatgagcgcctcagacacgcgccagcgccaggagtggacagctgccatccagatggcgatccggctgcaggccgaggggaagacgtccctacacaaggacctgaagcagaaacggcgcgagcagcgggagcagcggtag
Sequence Length
1011
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
73,910 Da
NCBI Official Full Name
Homo sapiens differentially expressed in FDCP 6 homolog (mouse), mRNA
NCBI Official Synonym Full Names
DEF6, guanine nucleotide exchange factor
NCBI Official Symbol
DEF6
NCBI Official Synonym Symbols
IBP; SLAT; SWAP70L
NCBI Protein Information
differentially expressed in FDCP 6 homolog
UniProt Protein Name
Differentially expressed in FDCP 6 homolog
UniProt Gene Name
DEF6
UniProt Synonym Gene Names
IBP; DEF-6
UniProt Entry Name
DEFI6_HUMAN

NCBI Description

DEF6, or IBP, is a guanine nucleotide exchange factor (GEF) for RAC (MIM 602048) and CDC42 (MIM 116952) that is highly expressed in B and T cells (Gupta et al., 2003 [PubMed 12923183]).[supplied by OMIM, Mar 2008]

Uniprot Description

DEF6: Phosphatidylinositol 3,4,5-trisphosphate-dependent guanine nucleotide exchange factor (GEF) which plays a role in the activation of Rho GTPases RAC1, RhoA and CDC42. Can regulate cell morphology in cooperation with activated RAC1. Plays a role in Th2 (T helper cells) development and/or activation, perhaps by interfering with ZAP70 signaling.

Protein type: GEFs, Rac/Rho; GEFs

Chromosomal Location of Human Ortholog: 6p21.33-p21.1

Cellular Component: membrane

Molecular Function: protein binding

Research Articles on DEF6

Similar Products

Product Notes

The DEF6 def6 (Catalog #AAA1270657) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccctgc gcaaggaact gctcaagtcc atctggtacg cctttaccgc gctggacgtg gagaagagtg gcaaagtctc caagtcccag ctcaaggtgc tgtcccacaa cctgtacacg gtcctgcaca tcccccatga ccccgtggcc ctggaggaac acttccgaga tgatgatgac ggccctgtgt ccagccaggg atacatgccc tacctcaaca agtacatcct ggacaaggtg gaggaggggg cttttgttaa agagcacttt gatgagctgt gctggacgct gacggccaag aagaactatc gggcagatag caacgggaac agtatgctct ccaatcagga tgccttccgc ctctggtgcc tcttcaactt cctgtctgag gacaagtacc ctctgatcat ggttcctgat gaggtggaat acctgctgaa aaaggtactc agcagcatga gcttggaggt gagcttgggt gagctggagg agcttctggc ccaggaggcc caggtggccc agaccaccgg ggggctcagc gtctggcagt tcctggagct cttcaattcg ggccgctgcc tgcggggcgt gggccgggac accctcagca tggccatcca cgaggtctac caggagctca tccaagatgt cctgaagcag ggctacctgt ggaagcgagg gcacctgaga aggaactggg ccgaacgctg gttccagctg cagcccagct gcctctgcta ctttgggagt gaagagtgca aagagaaaag gggcattatc ccgctggatg cacactgctg cgtggaggtg ctgccagacc gcgacggaaa gcgctgcatg ttctgtgtga agacagccac ccgcacgtat gagatgagcg cctcagacac gcgccagcgc caggagtgga cagctgccat ccagatggcg atccggctgc aggccgaggg gaagacgtcc ctacacaagg acctgaagca gaaacggcgc gagcagcggg agcagcggta g. It is sometimes possible for the material contained within the vial of "DEF6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.