OLAH cdna clone
OLAH cDNA Clone
Gene Names
OLAH; SAST; AURA1; THEDC1
Synonyms
OLAH; OLAH cDNA Clone; OLAH cdna clone
Sequence
atggagagaggagaccaacctaagagaaccaggaatgaaaacattttcaactgcttatacaaaaaccctgaggcaacttttaagctgatttgctttccctggatgggaggtggctccactcattttgccaaatggggccaagatactcatgatttgctggaagtgcactccttaaggcttcctggaagagaaagcagagttgaagaacctcttgaaaatgacatctcccagttagttgatgaagttgtttgtgctctgcagccagtcatccaggataaaccatttgcattttttggccacagtatgggatcctacattgcttttaggactgcactaggtctaaaagaaaacaatcaaccagaaccattgcatttatttttgtcaagtgcaactcctgtacattcaaaggcctggcatcgcattcccaaagatgatgaattgtcagaagaacaaataagtcattaccttatggaatttggaggcacccccaagcattttgctgaagccaaggaatttgtgaaacaatgtagtcccatcataagggcagatctgaacattgttagaagttgcacctctaacgtaccatctaaggctgttctttcctgtgacttgacatgttttgttggatctgaagacatagcaaaggacatggaagcctggaaagatgtaaccagtggaaatgctaaaatttaccagcttccagggggtcacttttatcttctggatcctgcgaacgagaaattaatcaagaactacataatcaagtgtctagaagtatcatcgatatccaatttttag
Sequence Length
798
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
35,818 Da
NCBI Official Full Name
Homo sapiens oleoyl-ACP hydrolase, mRNA
NCBI Official Synonym Full Names
oleoyl-ACP hydrolase
NCBI Official Symbol
OLAH
NCBI Official Synonym Symbols
SAST; AURA1; THEDC1
NCBI Protein Information
S-acyl fatty acid synthase thioesterase, medium chain
UniProt Protein Name
S-acyl fatty acid synthase thioesterase, medium chain
Protein Family
UniProt Gene Name
OLAH
UniProt Synonym Gene Names
THEDC1; AURA1
UniProt Entry Name
SAST_HUMAN
Uniprot Description
OLAH: In fatty acid biosynthesis chain termination and release of the free fatty acid product is achieved by hydrolysis of the thio ester by a thioesterase I, a component of the fatty acid synthetase complex. The chain length of the released fatty acid is usually C16. However, in the mammary glands of non-ruminant mammals, and in the uropygial gland of certain waterfowl there exists a second thioesterase which releases medium-chain length fatty acids (C8 to C2). Belongs to the thioesterase family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Lipid Metabolism - fatty acid biosynthesis; EC 3.1.2.14; Hydrolase
Chromosomal Location of Human Ortholog: 10p13
Biological Process: lipid biosynthetic process
Research Articles on OLAH
Similar Products
Product Notes
The OLAH olah (Catalog #AAA1270575) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagagag gagaccaacc taagagaacc aggaatgaaa acattttcaa ctgcttatac aaaaaccctg aggcaacttt taagctgatt tgctttccct ggatgggagg tggctccact cattttgcca aatggggcca agatactcat gatttgctgg aagtgcactc cttaaggctt cctggaagag aaagcagagt tgaagaacct cttgaaaatg acatctccca gttagttgat gaagttgttt gtgctctgca gccagtcatc caggataaac catttgcatt ttttggccac agtatgggat cctacattgc ttttaggact gcactaggtc taaaagaaaa caatcaacca gaaccattgc atttattttt gtcaagtgca actcctgtac attcaaaggc ctggcatcgc attcccaaag atgatgaatt gtcagaagaa caaataagtc attaccttat ggaatttgga ggcaccccca agcattttgc tgaagccaag gaatttgtga aacaatgtag tcccatcata agggcagatc tgaacattgt tagaagttgc acctctaacg taccatctaa ggctgttctt tcctgtgact tgacatgttt tgttggatct gaagacatag caaaggacat ggaagcctgg aaagatgtaa ccagtggaaa tgctaaaatt taccagcttc cagggggtca cttttatctt ctggatcctg cgaacgagaa attaatcaag aactacataa tcaagtgtct agaagtatca tcgatatcca atttttag. It is sometimes possible for the material contained within the vial of "OLAH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
