Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EPHX2 cdna clone

EPHX2 cDNA Clone

Gene Names
EPHX2; CEH; SEH
Synonyms
EPHX2; EPHX2 cDNA Clone; EPHX2 cdna clone
Ordering
For Research Use Only!
Sequence
atgacgctgcgcgcggccgtcttcgaccttgacggggtgctggcgctgccagcggtgttcggcgtcctcggccgcacggaggaggccctggcgctgcccagaggacttctgaatgatgctttccagaaagggggaccagagggtgccactacccggcttatgaaaggagagatcacactttcccagtggataccactcatggaagaaaactgcaggaagtgctccgagaccgctaaagtctgcctccccaagaatttctccataaaagaaatctttgacaaggcgatttcagccagaaagatcaaccgccccatgctccaggcagctctcatgctcaggaagaaaggattcactactgccatcctcaccaacacctggctggacgaccgtgctgagagagatggcctggcccagctgatgtgtgagctgaagatgcactttgacttcctgatagagtcgtgtcaggtgggaatggtcaaacctgaacctcagatctacaagtttctgctggacaccctgaaggccagccccagtgaggtcgtttttttggatgacatcggggctaatctgaagccagcccgtgacttgggaatggtcaccatcctggtccaggacactgacacggccctgaaagaactggagaaagtgaccggaatccagcttctcaataccccggcccctctgccgacctcttgcaatccaagtgacatgagccatgggtacgtgacagtaaagcccagggtccgtctgcattttgtggagctgggctccggccctgctgtgtgcctctgccatggatttcccgagagttggtattcttggaggtaccagatccctgctctggcccaggcaggttaccgggtcctagctatggacatgaaaggctatggagagtcatctgctcctcccgaaatagaagaatattgcatggaagtgttatgtaaggagatggtaaccttcctggataaactgggcctctctcaagcagtgttcattggccatgactggggtggcatgctggtgtggtacatggctctcttctaccccgagagagtgagggcggtggccagtttgaatactcccttcataccagcaaatcccaacatgtcccctttggagagtatcaaagccaacccagtatttgattaccagctctacttccaagaaccaggagtggctgaggctgaactggaacagaacctgagtcggactttcaaaagcctcttcagagcaagcgatgagagtgttttatccatgcataaagtctgtgaagcgggaggactttttgtaaatagcccagaagagcccagcctcagcaggatggtcactgaggaggaaatccagttctatgtgcagcagttcaagaagtctggtttcagaggtcctctaaactggtaccgaaacatggaaaggaactggaagtgggcttgcaaaagcttgggacggaagatcctgattccggccctgatggtcacggcggagaaggacttcgtgctcgttcctcagatgtcccagcacatggaggactggattccccacctgaaaaggggacacattgaggactgtgggcactggacacagatggacaagccaaccgaggtgaatcagatcctcattaagtggctggattctgatgcccggaacccaccggtggtctcaaagatgtag
Sequence Length
1668
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,626 Da
NCBI Official Full Name
Homo sapiens epoxide hydrolase 2, cytoplasmic, mRNA
NCBI Official Synonym Full Names
epoxide hydrolase 2
NCBI Official Symbol
EPHX2
NCBI Official Synonym Symbols
CEH; SEH
NCBI Protein Information
bifunctional epoxide hydrolase 2
UniProt Protein Name
Bifunctional epoxide hydrolase 2
UniProt Gene Name
EPHX2
UniProt Synonym Gene Names
CEH; SEH
UniProt Entry Name
HYES_HUMAN

NCBI Description

This gene encodes a member of the epoxide hydrolase family. The protein, found in both the cytosol and peroxisomes, binds to specific epoxides and converts them to the corresponding dihydrodiols. Mutations in this gene have been associated with familial hypercholesterolemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]

Uniprot Description

EPHX2: Bifunctional enzyme. The C-terminal domain has epoxide hydrolase activity and acts on epoxides (alkene oxides, oxiranes) and arene oxides. Plays a role in xenobiotic metabolism by degrading potentially toxic epoxides. Also determines steady-state levels of physiological mediators. The N-terminal domain has lipid phosphatase activity, with the highest activity towards threo- 9,10-phosphonooxy-hydroxy-octadecanoic acid, followed by erythro- 9,10-phosphonooxy-hydroxy-octadecanoic acid, 12-phosphonooxy- octadec-9Z-enoic acid, 12-phosphonooxy-octadec-9E-enoic acid, and p-nitrophenyl phospate. Belongs to the AB hydrolase superfamily. Epoxide hydrolase family.

Protein type: EC 3.3.2.10; Hydrolase; Lipid Metabolism - arachidonic acid; EC 3.1.3.76

Chromosomal Location of Human Ortholog: 8p21

Cellular Component: cytoplasm; cytosol; peroxisome

Molecular Function: epoxide hydrolase activity; lipid phosphatase activity; magnesium ion binding; phosphoric monoester hydrolase activity; protein homodimerization activity; receptor binding; toxin binding

Biological Process: cholesterol homeostasis; dephosphorylation; epoxygenase P450 pathway; phospholipid dephosphorylation; stilbene catabolic process

Disease: Hypercholesterolemia, Familial

Research Articles on EPHX2

Similar Products

Product Notes

The EPHX2 ephx2 (Catalog #AAA1270428) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacgctgc gcgcggccgt cttcgacctt gacggggtgc tggcgctgcc agcggtgttc ggcgtcctcg gccgcacgga ggaggccctg gcgctgccca gaggacttct gaatgatgct ttccagaaag ggggaccaga gggtgccact acccggctta tgaaaggaga gatcacactt tcccagtgga taccactcat ggaagaaaac tgcaggaagt gctccgagac cgctaaagtc tgcctcccca agaatttctc cataaaagaa atctttgaca aggcgatttc agccagaaag atcaaccgcc ccatgctcca ggcagctctc atgctcagga agaaaggatt cactactgcc atcctcacca acacctggct ggacgaccgt gctgagagag atggcctggc ccagctgatg tgtgagctga agatgcactt tgacttcctg atagagtcgt gtcaggtggg aatggtcaaa cctgaacctc agatctacaa gtttctgctg gacaccctga aggccagccc cagtgaggtc gtttttttgg atgacatcgg ggctaatctg aagccagccc gtgacttggg aatggtcacc atcctggtcc aggacactga cacggccctg aaagaactgg agaaagtgac cggaatccag cttctcaata ccccggcccc tctgccgacc tcttgcaatc caagtgacat gagccatggg tacgtgacag taaagcccag ggtccgtctg cattttgtgg agctgggctc cggccctgct gtgtgcctct gccatggatt tcccgagagt tggtattctt ggaggtacca gatccctgct ctggcccagg caggttaccg ggtcctagct atggacatga aaggctatgg agagtcatct gctcctcccg aaatagaaga atattgcatg gaagtgttat gtaaggagat ggtaaccttc ctggataaac tgggcctctc tcaagcagtg ttcattggcc atgactgggg tggcatgctg gtgtggtaca tggctctctt ctaccccgag agagtgaggg cggtggccag tttgaatact cccttcatac cagcaaatcc caacatgtcc cctttggaga gtatcaaagc caacccagta tttgattacc agctctactt ccaagaacca ggagtggctg aggctgaact ggaacagaac ctgagtcgga ctttcaaaag cctcttcaga gcaagcgatg agagtgtttt atccatgcat aaagtctgtg aagcgggagg actttttgta aatagcccag aagagcccag cctcagcagg atggtcactg aggaggaaat ccagttctat gtgcagcagt tcaagaagtc tggtttcaga ggtcctctaa actggtaccg aaacatggaa aggaactgga agtgggcttg caaaagcttg ggacggaaga tcctgattcc ggccctgatg gtcacggcgg agaaggactt cgtgctcgtt cctcagatgt cccagcacat ggaggactgg attccccacc tgaaaagggg acacattgag gactgtgggc actggacaca gatggacaag ccaaccgagg tgaatcagat cctcattaag tggctggatt ctgatgcccg gaacccaccg gtggtctcaa agatgtag. It is sometimes possible for the material contained within the vial of "EPHX2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.