GSPT2 cdna clone
GSPT2 cDNA Clone
Gene Names
GSPT2; GST2; ERF3B
Synonyms
GSPT2; GSPT2 cDNA Clone; GSPT2 cdna clone
Sequence
atggattcgggtagcagcagcagcgactcggcgcccgattgctgggaccaggtggacatggaatccacggggtcggccccgagcggggatggagtctcctctgcggtggccgaggcccagcgcgagcccctcagctcggctttcagccgtaagctcaacgtcaacgccaagcccttcgtgcctaacgtacacgccgcggagttcgtgccgtccttcctgcggggcccgactcagccgcccaccctcccggccggctccggcagcaacgatgaaacctgcaccggcgcgggataccctcaaggtaaaaggatgggacggggggcacctgtggaaccttcccgagaggaaccgttagtgtcgcttgaaggttccaattcagccgttaccatggaactttcagaacctgttgtagaaaatggagaggtggaaatggccctagaagaatcatgggagcacagtaaagaagtaagtgaagccgagcctgggggtggttcctcgggagattcagggcccccagaagaaagtggccaggaaatgatggaggaaaaagaggaaataagaaaatccaaatctgtgatcgtaccctcaggtgcacctaagaaagaacacgtaaatgtagtattcattggccatgtagacgctggcaagtcaaccatcggaggacagataatgtttttgactggaatggttgacaaaagaacactggagaaatatgaaagagaagctaaggaaaaaaacagagaaacctggtatttgtcctgggccttagatacaaatcaggaggaacgagacaagggtaaaacagtcgaagtgggtcgtgcctattttgaaacagaaaggaaacatttcacaattttagatgcccctggccacaagagttttgtcccaaatatgattggtggtgcttctcaagctgatttggctgtgctggtcatctctgccaggaaaggagagtttgaaactggatttgaaaaaggtggacagacaagagaacatgcgatgttggcaaaaacggcaggggtaaaacatttaatagtgcttattaataagatggatgatcacacagtaaattggagcatcgagagatatgaagaatgtaaagaaaaactggtgccctttttgaaaaaagtaggcttcagtccaaaaaaggacattcactttatgccctgctcaggactgaccggagcaaatattaaagagcagtcagatttctgcccttggtacactggattaccatttattccgtatttggataacttgccaaacttcaacagatcaattgatggaccaataagactgccaattgtggataagtacaaagatatgggcactgtggtcctgggaaagctggaatccgggtccatttttaaaggccagcagctcgtgatgatgccaaacaagcacaatgtagaagttcttggaatactttctgatgatactgaaactgattttgtagccccaggtgaaaacctcaaaatcagactgaagggaattgaagaagaagagattcttccaggattcatactttgtgatcctagtaacctctgccattctggacgcacgtttgatgttcagatagtgattattgagcacaaatccatcatctgcccaggttataatgcggtgctgcacattcatacttgtattgaggaagttgagataacagcgttaatctccttggtagacaaaaaatcaggagaaaaaagtaagacacgaccccgcttcgtgaaacaagatcaagtatgcattgctcgtttaaggacagcaggaaccatctgcctcgagacgttcaaagattttcctcagatgggtcgttttactttaagagatgagggtaagaccattgcaattggaaaagttctgaaattggtccaagagaaggactaa
Sequence Length
1887
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
68,883 Da
NCBI Official Full Name
Homo sapiens G1 to S phase transition 2, mRNA
NCBI Official Synonym Full Names
G1 to S phase transition 2
NCBI Official Symbol
GSPT2
NCBI Official Synonym Symbols
GST2; ERF3B
NCBI Protein Information
eukaryotic peptide chain release factor GTP-binding subunit ERF3B
UniProt Protein Name
Eukaryotic peptide chain release factor GTP-binding subunit ERF3B
Protein Family
UniProt Gene Name
GSPT2
UniProt Synonym Gene Names
ERF3B; Eukaryotic peptide chain release factor subunit 3b; eRF3b
UniProt Entry Name
ERF3B_HUMAN
NCBI Description
This gene encodes a GTPase that belongs to the GTP-binding elongation factor family. The encoded protein is a polypeptide release factor that complexes with eukaryotic peptide chain release factor 1 to mediate translation termination. This protein may also be involved in mRNA stability.[provided by RefSeq, Mar 2010]
Uniprot Description
GSPT2: Involved in translation termination in response to the termination codons UAA, UAG and UGA. May play a role as a potent stimulator of the release factor activity of ETF1. Exhibits GTPase activity, which is ribosome- and ETF1-dependent. May play a role in cell cycle progression. Component of the transient SURF complex which recruits UPF1 to stalled ribosomes in the context of nonsense-mediated decay (NMD) of mRNAs containing premature stop codons. Belongs to the GTP-binding elongation factor family. ERF3 subfamily.
Protein type: RNA-binding; Hydrolase; Translation
Chromosomal Location of Human Ortholog: Xp11.22
Cellular Component: cytosol
Molecular Function: GTPase activity; protein binding; translation release factor activity
Biological Process: mRNA catabolic process, nonsense-mediated decay; translational termination
Research Articles on GSPT2
Similar Products
Product Notes
The GSPT2 gspt2 (Catalog #AAA1270412) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggattcgg gtagcagcag cagcgactcg gcgcccgatt gctgggacca ggtggacatg gaatccacgg ggtcggcccc gagcggggat ggagtctcct ctgcggtggc cgaggcccag cgcgagcccc tcagctcggc tttcagccgt aagctcaacg tcaacgccaa gcccttcgtg cctaacgtac acgccgcgga gttcgtgccg tccttcctgc ggggcccgac tcagccgccc accctcccgg ccggctccgg cagcaacgat gaaacctgca ccggcgcggg ataccctcaa ggtaaaagga tgggacgggg ggcacctgtg gaaccttccc gagaggaacc gttagtgtcg cttgaaggtt ccaattcagc cgttaccatg gaactttcag aacctgttgt agaaaatgga gaggtggaaa tggccctaga agaatcatgg gagcacagta aagaagtaag tgaagccgag cctgggggtg gttcctcggg agattcaggg cccccagaag aaagtggcca ggaaatgatg gaggaaaaag aggaaataag aaaatccaaa tctgtgatcg taccctcagg tgcacctaag aaagaacacg taaatgtagt attcattggc catgtagacg ctggcaagtc aaccatcgga ggacagataa tgtttttgac tggaatggtt gacaaaagaa cactggagaa atatgaaaga gaagctaagg aaaaaaacag agaaacctgg tatttgtcct gggccttaga tacaaatcag gaggaacgag acaagggtaa aacagtcgaa gtgggtcgtg cctattttga aacagaaagg aaacatttca caattttaga tgcccctggc cacaagagtt ttgtcccaaa tatgattggt ggtgcttctc aagctgattt ggctgtgctg gtcatctctg ccaggaaagg agagtttgaa actggatttg aaaaaggtgg acagacaaga gaacatgcga tgttggcaaa aacggcaggg gtaaaacatt taatagtgct tattaataag atggatgatc acacagtaaa ttggagcatc gagagatatg aagaatgtaa agaaaaactg gtgccctttt tgaaaaaagt aggcttcagt ccaaaaaagg acattcactt tatgccctgc tcaggactga ccggagcaaa tattaaagag cagtcagatt tctgcccttg gtacactgga ttaccattta ttccgtattt ggataacttg ccaaacttca acagatcaat tgatggacca ataagactgc caattgtgga taagtacaaa gatatgggca ctgtggtcct gggaaagctg gaatccgggt ccatttttaa aggccagcag ctcgtgatga tgccaaacaa gcacaatgta gaagttcttg gaatactttc tgatgatact gaaactgatt ttgtagcccc aggtgaaaac ctcaaaatca gactgaaggg aattgaagaa gaagagattc ttccaggatt catactttgt gatcctagta acctctgcca ttctggacgc acgtttgatg ttcagatagt gattattgag cacaaatcca tcatctgccc aggttataat gcggtgctgc acattcatac ttgtattgag gaagttgaga taacagcgtt aatctccttg gtagacaaaa aatcaggaga aaaaagtaag acacgacccc gcttcgtgaa acaagatcaa gtatgcattg ctcgtttaag gacagcagga accatctgcc tcgagacgtt caaagatttt cctcagatgg gtcgttttac tttaagagat gagggtaaga ccattgcaat tggaaaagtt ctgaaattgg tccaagagaa ggactaa. It is sometimes possible for the material contained within the vial of "GSPT2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
