NTN5 cdna clone
NTN5 cDNA Clone
Synonyms
NTN5; NTN5 cDNA Clone; NTN5 cdna clone
Sequence
atgcccgtgacctttgccctcctgctcctcctgggccaggccactgcggacccatgctacgatccacagggccgcccccaattctgcctcccgccagtgacacagctggctgccgtggcggcctcctgccctcaggcctgtgccctgtccccaggaaaccaccttggcgccagggaaacctgcaatggcagcctgactttggccctgggtggccccttcctcctgacatctgtcagcttgcgcttctgtaccccaggacccccagccctcatcctgtctgctgcctgggcctcagggggtccctggaggctgctgtggcacaggcccgcctggcctggggccttagggggccctgaaagggtgaccttccactccacaccaggtcctaaggccactgtggcggccagccacctccgtgtggagtttgggggccaggccgggctagcggcagctgggctgagaggccgctgccagtgtcatggccacgctgcccgctgtgccgcccgtgcccggcccccccgctgccactgccgccaccataccactggcccggggtgcgagagctgccgcccgtcccatcgagactggccctggcggcctgccacgccccggcacccccacccttgcctaccctgctcctgcaaccagcacgcccgacgctgccggttcaactctgagctgttcagactgtcgggcggccggagtgggggtgtttgtgagcggtgccgccaccacacagctgggcggcactgccactactgccaacctgggttctggagggaccctagccagcctatcttcagccgcagggcctgcagagcctgccagtgccaccctattggggcaacaggaggaacctgcaaccagaccagtgggcagtgcacctgcaagttaggggtcacaggcctgacctgcaaccgctgtggccctggctaccagcagagccgctcccccaggatgccctgccagcgaattccagaggcaacaaccacccttgccactactcctggtgcttatagctctgaccctcagtgtcaaaactactgcaatatgtcggacaccagggtacacatgagccttcggaggtactgccagcaggaccatgttctccgcgcgcaggtgctagcgtccgaggcggcgggcccggcatggcagcggctggccgtgcgcgtgctggccgtttacaagcagcgggcgcagcccgtgcgacgcggcgaccaggacgcctgggtgccccgcgccgacctgacctgcggctgcctgcgcctgcagccaggcaccgactacctgctgctgggcagcgccgtgggcgaccccgaccccacgcgcctcatcctcgaccgccacggcctcgcgctgccatggaggccgcgctgggcccggcccctgaagcggctgcagcaggaggagcgcgccggaggctgccgcggcgtgcgggcacccacacccagccccaggccggagcactag
Sequence Length
1470
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
37,332 Da
NCBI Official Full Name
Homo sapiens netrin 5, mRNA
NCBI Official Synonym Full Names
netrin 5
NCBI Official Symbol
NTN5
NCBI Protein Information
netrin-5
UniProt Protein Name
Netrin-5
Protein Family
UniProt Gene Name
NTN5
UniProt Entry Name
NET5_HUMAN
Uniprot Description
NTN5: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Secreted, signal peptide; Secreted
Chromosomal Location of Human Ortholog: 19q13.33
Similar Products
Product Notes
The NTN5 ntn5 (Catalog #AAA1270403) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccgtga cctttgccct cctgctcctc ctgggccagg ccactgcgga cccatgctac gatccacagg gccgccccca attctgcctc ccgccagtga cacagctggc tgccgtggcg gcctcctgcc ctcaggcctg tgccctgtcc ccaggaaacc accttggcgc cagggaaacc tgcaatggca gcctgacttt ggccctgggt ggccccttcc tcctgacatc tgtcagcttg cgcttctgta ccccaggacc cccagccctc atcctgtctg ctgcctgggc ctcagggggt ccctggaggc tgctgtggca caggcccgcc tggcctgggg ccttaggggg ccctgaaagg gtgaccttcc actccacacc aggtcctaag gccactgtgg cggccagcca cctccgtgtg gagtttgggg gccaggccgg gctagcggca gctgggctga gaggccgctg ccagtgtcat ggccacgctg cccgctgtgc cgcccgtgcc cggccccccc gctgccactg ccgccaccat accactggcc cggggtgcga gagctgccgc ccgtcccatc gagactggcc ctggcggcct gccacgcccc ggcaccccca cccttgccta ccctgctcct gcaaccagca cgcccgacgc tgccggttca actctgagct gttcagactg tcgggcggcc ggagtggggg tgtttgtgag cggtgccgcc accacacagc tgggcggcac tgccactact gccaacctgg gttctggagg gaccctagcc agcctatctt cagccgcagg gcctgcagag cctgccagtg ccaccctatt ggggcaacag gaggaacctg caaccagacc agtgggcagt gcacctgcaa gttaggggtc acaggcctga cctgcaaccg ctgtggccct ggctaccagc agagccgctc ccccaggatg ccctgccagc gaattccaga ggcaacaacc acccttgcca ctactcctgg tgcttatagc tctgaccctc agtgtcaaaa ctactgcaat atgtcggaca ccagggtaca catgagcctt cggaggtact gccagcagga ccatgttctc cgcgcgcagg tgctagcgtc cgaggcggcg ggcccggcat ggcagcggct ggccgtgcgc gtgctggccg tttacaagca gcgggcgcag cccgtgcgac gcggcgacca ggacgcctgg gtgccccgcg ccgacctgac ctgcggctgc ctgcgcctgc agccaggcac cgactacctg ctgctgggca gcgccgtggg cgaccccgac cccacgcgcc tcatcctcga ccgccacggc ctcgcgctgc catggaggcc gcgctgggcc cggcccctga agcggctgca gcaggaggag cgcgccggag gctgccgcgg cgtgcgggca cccacaccca gccccaggcc ggagcactag. It is sometimes possible for the material contained within the vial of "NTN5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
