Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EIF5 cdna clone

EIF5 cDNA Clone

Gene Names
EIF5; EIF-5; EIF-5A
Synonyms
EIF5; EIF5 cDNA Clone; EIF5 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctgtcaatgtcaaccgcagcgtgtcagaccagttctatcgctacaagatgccccgtctgattgccaaggttgagggcaaaggcaatggaatcaagacagttatagtcaacatggttgacgttgcaaaggcgcttaatcggcctccaacgtatcccaccaaatattttggttgtgagctgggagcacagacccagtttgatgttaagaatgaccgttacattgtcaatggatctcatgaggcgaataagctgcaagacatgttggatggattcattaaaaaatttgttctctgtcctgaatgtgagaatcctgaaacagatttgcatgtcaatccaaagaagcaaacaataggtaattcttgtaaagcctgtggctatcgaggcatgcttgacacacatcataaactctgcacattcattctcaaaaacccacctgagaatagtgacagtggtacaggaaagaaagaaaaagaaaagaaaaacagaaagggcaaagacaaggaaaatggctccgtatccagcagtgagacaccaccaccaccaccaccaccaaatgaaattaatcctcctccacatacaatggaagaagaggaggatgatgactggggagaagatacaactgaggaagctcaaaggcgtcgaatggatgaaatcagtgaccatgcaaaagttctgacactcagtgatgatttggaaagaacaattgaggagagggtcaatatcctctttgattttgttaagaaaaagaaagaagagggtgttattgattcatctgacaaagaaatcgttgctgaagcagaaagactggatgtaaaagccatgggccctcttgttctaactgaagttctttttaatgagaagattagagaacagattaagaaatacaggcgccatttcctacgattttgtcacaacaacaaaaaagcccaacggtaccttcttcatggtttggagtgtgtggtagcaatgcatcaagctcagcttatctccaagattccacatatcttgaaggagatgtacgatgcagaccttttagaagaagaggtcatcatcagctggtcggaaaaggcctctaagaaatatgtctccaaagaacttgccaaagagattcgtgtcaaagcagaaccatttataaaatggttgaaggaggcagaggaagaatcttctggtggcgaagaagaagatgaagatgagaacattgaggtggtgtattcgaaggctgccagtgtaccgaaagttgagactgtaaagtcagacaacaaggatgacgacatcgatattgatgccatttaa
Sequence Length
1296
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,223 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 5, mRNA
NCBI Official Synonym Full Names
eukaryotic translation initiation factor 5
NCBI Official Symbol
EIF5
NCBI Official Synonym Symbols
EIF-5; EIF-5A
NCBI Protein Information
eukaryotic translation initiation factor 5
UniProt Protein Name
Eukaryotic translation initiation factor 5
UniProt Gene Name
EIF5
UniProt Synonym Gene Names
eIF-5
UniProt Entry Name
IF5_HUMAN

NCBI Description

Eukaryotic translation initiation factor-5 (EIF5) interacts with the 40S initiation complex to promote hydrolysis of bound GTP with concomitant joining of the 60S ribosomal subunit to the 40S initiation complex. The resulting functional 80S ribosomal initiation complex is then active in peptidyl transfer and chain elongations (summary by Si et al., 1996 [PubMed 8663286]).[supplied by OMIM, May 2010]

Uniprot Description

EIF5: eukaryotic translation initiation factor 5. Catalyzes the hydrolysis of GTP bound to the 40S ribosomal initiation complex (40S.mRNA.Met-tRNA[F].eIF-2.GTP) with the subsequent joining of a 60S ribosomal subunit resulting in the release of eIF-2 and the guanine nucleotide. The subsequent joining of a 60S ribosomal subunit results in the formation of a functional 80S initiation complex.

Protein type: Translation initiation; Translation

Chromosomal Location of Human Ortholog: 14q32.32

Cellular Component: cell-cell adherens junction; cytoplasm; cytosol; nucleus; plasma membrane

Molecular Function: GTPase activity; protein binding; translation factor activity, nucleic acid binding

Biological Process: regulation of translational initiation

Research Articles on EIF5

Similar Products

Product Notes

The EIF5 eif5 (Catalog #AAA1270353) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgtca atgtcaaccg cagcgtgtca gaccagttct atcgctacaa gatgccccgt ctgattgcca aggttgaggg caaaggcaat ggaatcaaga cagttatagt caacatggtt gacgttgcaa aggcgcttaa tcggcctcca acgtatccca ccaaatattt tggttgtgag ctgggagcac agacccagtt tgatgttaag aatgaccgtt acattgtcaa tggatctcat gaggcgaata agctgcaaga catgttggat ggattcatta aaaaatttgt tctctgtcct gaatgtgaga atcctgaaac agatttgcat gtcaatccaa agaagcaaac aataggtaat tcttgtaaag cctgtggcta tcgaggcatg cttgacacac atcataaact ctgcacattc attctcaaaa acccacctga gaatagtgac agtggtacag gaaagaaaga aaaagaaaag aaaaacagaa agggcaaaga caaggaaaat ggctccgtat ccagcagtga gacaccacca ccaccaccac caccaaatga aattaatcct cctccacata caatggaaga agaggaggat gatgactggg gagaagatac aactgaggaa gctcaaaggc gtcgaatgga tgaaatcagt gaccatgcaa aagttctgac actcagtgat gatttggaaa gaacaattga ggagagggtc aatatcctct ttgattttgt taagaaaaag aaagaagagg gtgttattga ttcatctgac aaagaaatcg ttgctgaagc agaaagactg gatgtaaaag ccatgggccc tcttgttcta actgaagttc tttttaatga gaagattaga gaacagatta agaaatacag gcgccatttc ctacgatttt gtcacaacaa caaaaaagcc caacggtacc ttcttcatgg tttggagtgt gtggtagcaa tgcatcaagc tcagcttatc tccaagattc cacatatctt gaaggagatg tacgatgcag accttttaga agaagaggtc atcatcagct ggtcggaaaa ggcctctaag aaatatgtct ccaaagaact tgccaaagag attcgtgtca aagcagaacc atttataaaa tggttgaagg aggcagagga agaatcttct ggtggcgaag aagaagatga agatgagaac attgaggtgg tgtattcgaa ggctgccagt gtaccgaaag ttgagactgt aaagtcagac aacaaggatg acgacatcga tattgatgcc atttaa. It is sometimes possible for the material contained within the vial of "EIF5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.