Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UFM1 cdna clone

UFM1 cDNA Clone

Gene Names
UFM1; BM-002; C13orf20
Synonyms
UFM1; UFM1 cDNA Clone; UFM1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgaaggtttcctttaagatcacgctgacgtcggacccacggctgccgtacaaagtactcagtgttcctgaaagtacacctttcacagcagtcttaaagtttgcagcagaagaatttaaagttcctgctgcaacaagtgcaattattaccaatgatggaataggaataaatcctgcacagactgctggaaatgtttttctaaaacatggttcagaactgcggattattcctagagatcgtgttggaagttgttaa
Sequence Length
258
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,960 Da
NCBI Official Full Name
Homo sapiens ubiquitin-fold modifier 1, mRNA
NCBI Official Synonym Full Names
ubiquitin fold modifier 1
NCBI Official Symbol
UFM1
NCBI Official Synonym Symbols
BM-002; C13orf20
NCBI Protein Information
ubiquitin-fold modifier 1
UniProt Protein Name
Ubiquitin-fold modifier 1
Protein Family
UniProt Gene Name
UFM1
UniProt Synonym Gene Names
C13orf20
UniProt Entry Name
UFM1_HUMAN

NCBI Description

UFM1 is a ubiquitin-like protein that is conjugated to target proteins by E1-like activating enzyme UBA5 (UBE1DC1; MIM 610552) and E2-like conjugating enzyme UFC1 (MIM 610554) in a manner analogous to ubiquitylation (see UBE2M; MIM 603173) (Komatsu et al., 2004 [PubMed 15071506]).[supplied by OMIM, Dec 2008]

Uniprot Description

UFM1: Ubiquitin-like modifier protein which binds to a number of target proteins, such as DDRGK1. Belongs to the UFM1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin-like modifier

Chromosomal Location of Human Ortholog: 13q13.3

Cellular Component: cytoplasm; nucleus

Biological Process: regulation of estrogen receptor signaling pathway

Research Articles on UFM1

Similar Products

Product Notes

The UFM1 ufm1 (Catalog #AAA1270312) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgaagg tttcctttaa gatcacgctg acgtcggacc cacggctgcc gtacaaagta ctcagtgttc ctgaaagtac acctttcaca gcagtcttaa agtttgcagc agaagaattt aaagttcctg ctgcaacaag tgcaattatt accaatgatg gaataggaat aaatcctgca cagactgctg gaaatgtttt tctaaaacat ggttcagaac tgcggattat tcctagagat cgtgttggaa gttgttaa. It is sometimes possible for the material contained within the vial of "UFM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.