Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FADD cdna clone

FADD cDNA Clone

Gene Names
FADD; GIG3; MORT1
Synonyms
FADD; FADD cDNA Clone; FADD cdna clone
Ordering
For Research Use Only!
Sequence
atggacccgttcctggtgctgctgcactcggtgtcgtccagcctgtcgagcagcgagctgaccgagctcaagttcctatgcctcgggcgcgtgggcaagcgcaagctggagcgcgtgcagagcggcctagacctcttctccatgctgctggagcagaacgacctggagcccgggcacaccgagctcctgcgcgagctgctcgcctccctgcggcgccacgacctgctgcggcgcgtcgacgacttcgaggcgggggcggcggccggggccgcgcctggggaagaagacctgtgtgcagcatttaacgtcatatgtgataatgtggggaaagattggagaaggctggctcgtcagctcaaagtctcagacaccaagatcgacagcatcgaggacagatacccccgcaacctgacagagcgtgtgcgggagtcactgagaatctggaagaacacagagaaggagaacgcaacagtggcccacctggtgggggctctcaggtcctgccagatgaacctggtggctgacctggtacaagaggttcagcaggcccgtgacctccagaacaggagtggggccatgtccccgatgtcatggaactcagacgcatctacctccgaagcgtcctga
Sequence Length
627
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,279 Da
NCBI Official Full Name
Homo sapiens Fas (TNFRSF6)-associated via death domain, mRNA
NCBI Official Synonym Full Names
Fas associated via death domain
NCBI Official Symbol
FADD
NCBI Official Synonym Symbols
GIG3; MORT1
NCBI Protein Information
FAS-associated death domain protein
UniProt Protein Name
FAS-associated death domain protein
UniProt Gene Name
FADD
UniProt Synonym Gene Names
MORT1
UniProt Entry Name
FADD_HUMAN

NCBI Description

The protein encoded by this gene is an adaptor molecule that interacts with various cell surface receptors and mediates cell apoptotic signals. Through its C-terminal death domain, this protein can be recruited by TNFRSF6/Fas-receptor, tumor necrosis factor receptor, TNFRSF25, and TNFSF10/TRAIL-receptor, and thus it participates in the death signaling initiated by these receptors. Interaction of this protein with the receptors unmasks the N-terminal effector domain of this protein, which allows it to recruit caspase-8, and thereby activate the cysteine protease cascade. Knockout studies in mice also suggest the importance of this protein in early T cell development. [provided by RefSeq, Jul 2008]

Uniprot Description

FADD: an adaptor molecule that mediates apoptosis. Recruited through its C-terminal death domain by Fas-receptor, tumor necrosis factor receptor, TNFRSF25, and TRAIL-receptor, participating in the death signaling initiated by these receptors. Interaction with the receptors unmasks the N-terminal effector domain of this protein, which recruits caspase-8, and thereby activates the cysteine protease cascade. Knockout studies in mice also suggest the importance of this protein in early T cell development.

Protein type: Apoptosis; Adaptor/scaffold

Chromosomal Location of Human Ortholog: 11q13.3

Cellular Component: CD95 death-inducing signaling complex; cytoplasm; cytosol; plasma membrane

Molecular Function: identical protein binding; protease binding; protein binding; tumor necrosis factor receptor superfamily binding

Biological Process: apoptosis; caspase activation; cell surface receptor linked signal transduction; defense response to virus; induction of apoptosis via death domain receptors; lymph node development; positive regulation of activated T cell proliferation; positive regulation of adaptive immune response; positive regulation of apoptosis; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of interferon-gamma production; positive regulation of interleukin-8 production; positive regulation of macrophage differentiation; positive regulation of proteolysis; positive regulation of T cell mediated cytotoxicity; positive regulation of transcription from RNA polymerase II promoter; positive regulation of tumor necrosis factor production; spleen development; T cell differentiation in the thymus; T cell homeostasis; thymus development

Disease: Infections, Recurrent, With Encephalopathy, Hepatic Dysfunction, And Cardiovascular Malformations

Research Articles on FADD

Similar Products

Product Notes

The FADD fadd (Catalog #AAA1270070) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacccgt tcctggtgct gctgcactcg gtgtcgtcca gcctgtcgag cagcgagctg accgagctca agttcctatg cctcgggcgc gtgggcaagc gcaagctgga gcgcgtgcag agcggcctag acctcttctc catgctgctg gagcagaacg acctggagcc cgggcacacc gagctcctgc gcgagctgct cgcctccctg cggcgccacg acctgctgcg gcgcgtcgac gacttcgagg cgggggcggc ggccggggcc gcgcctgggg aagaagacct gtgtgcagca tttaacgtca tatgtgataa tgtggggaaa gattggagaa ggctggctcg tcagctcaaa gtctcagaca ccaagatcga cagcatcgag gacagatacc cccgcaacct gacagagcgt gtgcgggagt cactgagaat ctggaagaac acagagaagg agaacgcaac agtggcccac ctggtggggg ctctcaggtc ctgccagatg aacctggtgg ctgacctggt acaagaggtt cagcaggccc gtgacctcca gaacaggagt ggggccatgt ccccgatgtc atggaactca gacgcatcta cctccgaagc gtcctga. It is sometimes possible for the material contained within the vial of "FADD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.