Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CRTC1 cdna clone

CRTC1 cDNA Clone

Gene Names
CRTC1; MECT1; TORC1; TORC-1; WAMTP1
Synonyms
CRTC1; CRTC1 cDNA Clone; CRTC1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgacttcgaacaatccgcggaaattcagcgagaagatcgcgctgcacaatcagaagcaggcggaggagacggcggccttcgaggaggtcatgaaggacctgagcctgacgcgggccgcgcggctccagctccagaaatcccagtacctgcaactgggccccagccgaggccagtactatggcgggtccctgcccaacgtgaaccagatcgggagtggcaccatggacctgcccttccagacccccttccaatcctcgggcctggacaccagccggaccacccggcaccatgggctggtggacagggtgtaccgggagcgtggccggctcggctccccacaccgccggcccctgtcagtggacaaacacggacggcaggccgacagctgcccctatggcaccatgtacctctcaccacccgcggacaccagctggagaaggaccaattctgactccgccctgcaccagagcacaatgacgcccacgcagccagaatcctttagcagtgggtcccaggacgtgcaccagaaaagagtcttactgttaacagtcccaggaatggaagagaccacatcagaggcagacaaaaacctttccaagcaagcatgggacaccaagaagacggggtccaggcccaagtcctgtgaggtccccggaatcaacatcttcccgtctgccgaccaggaaaacactacagccctgatccccgccacccacaacacaggggggtccctgcccgacctgaccaacatccacttcccctccccgctcccgaccccgctggaccccgaggagcccaccttccctgcactgagcagctccagcagcaccggcaacctcgcggccaacctgacgcacctgggcatcggtggcgccggccagggaatgagcacacctggctcctctccacagcaccgcccagctggcgtcagccccctgtccctgagcacagaggcaaggcgtcagcaggcatcgcccgccctgtccccgctgtcacccatcactcaggctgtagccatggacgccctgtctctggagcagcagctgccctacgccttcttcacccaggcgggctcccagcagccaccgccgcagccccagcccccgccgcctcctccacccgcgtcccagcagccaccacccccgccacccccacaggcgcccgtccgcctgccccctggtggccccctgttgcccagcgccagcctgactcgtgggccacagccgcccccgcttgcagtcacggtaccgtcctctctcccccagtcccccccagagaaccctggccagccatcgatggggatcgacatcgcctcggcgccggctctgcagcagtaccgcactagcgccggctccccggccaaccagtctcccacctcgccagtctccaatcaaggcttctccccagggagctccccgcaacacacttccaccctgggcagcgtgtttggggacgcgtactatgagcagcagatggcggccaggcaggccaatgctctgtcccaccagctggagcagttcaacatgatggagaacgccatcagctccagcagcctgtacagcccgggctccacactcaactactcgcaggcggccatgatgggcctcacgggcagccacgggagcctgccggactcgcagcaactgggatacgccagccacagtggcatccccaacatcatcctcacagtgacaggagagtccccccccagcctctctaaagaactgaccagctctctggccggggtcggcgacgtcagcttcgactccgacagccagtttcccctggacgaactcaagatcgaccccctgaccctcgacggactgcacatgctcaacgaccccgacatggttctggccgacccagccaccgaggacaccttccggatggaccgcctgtga
Sequence Length
1905
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
62,530 Da
NCBI Official Full Name
Homo sapiens CREB regulated transcription coactivator 1, mRNA
NCBI Official Synonym Full Names
CREB regulated transcription coactivator 1
NCBI Official Symbol
CRTC1
NCBI Official Synonym Symbols
MECT1; TORC1; TORC-1; WAMTP1
NCBI Protein Information
CREB-regulated transcription coactivator 1
UniProt Protein Name
CREB-regulated transcription coactivator 1
UniProt Gene Name
CRTC1
UniProt Synonym Gene Names
TORC-1; Transducer of CREB protein 1
UniProt Entry Name
CRTC1_HUMAN

Uniprot Description

TORC1: Transcriptional coactivator for CREB1 which activates transcription through both consensus and variant cAMP response element (CRE) sites. Acts as a coactivator, in the SIK/TORC signaling pathway, being active when dephosphorylated and acts independently of CREB1 'Ser-133' phosphorylation. Enhances the interaction of CREB1 with TAF4. Regulates the expression of specific CREB-activated genes such as the steroidogenic gene, StAR. Potent coactivator of PGC1alpha and inducer of mitochondrial biogenesis in muscle cells. Also coactivator for TAX activation of the human T-cell leukemia virus type 1 (HTLV-1) long terminal repeats (LTR). In the hippocampus, involved in late-phase long- term potentiation (L-LTP) maintenance at the Schaffer collateral- CA1 synapses. May be required for dendritic growth of developing cortical neurons. Binds, as a tetramer, through its N-terminal region, with the bZIP domain of CREB1. 'Arg-314' in the bZIP domain of CREB1 is essential for this interaction. Interaction, via its C-terminal, with TAF4, enhances recruitment of TAF4 to CREB1. Binds HTLV1 Tax. Highly expressed in adult and fetal brain. Located to specific regions such as the prefrontal cortex and cerebellum. Very low expression in other tissues such as heart, spleen, lung, skeletal muscle, salivary gland, ovary and kidney. Belongs to the TORC family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription factor

Chromosomal Location of Human Ortholog: 19p13.11

Cellular Component: cytoplasm; nucleoplasm; nucleus; plasma membrane

Molecular Function: cAMP response element binding protein binding; protein binding

Biological Process: activation of CREB transcription factor; entrainment of circadian clock by photoperiod; positive regulation of transcription from RNA polymerase II promoter

Research Articles on CRTC1

Similar Products

Product Notes

The CRTC1 crtc1 (Catalog #AAA1270043) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgactt cgaacaatcc gcggaaattc agcgagaaga tcgcgctgca caatcagaag caggcggagg agacggcggc cttcgaggag gtcatgaagg acctgagcct gacgcgggcc gcgcggctcc agctccagaa atcccagtac ctgcaactgg gccccagccg aggccagtac tatggcgggt ccctgcccaa cgtgaaccag atcgggagtg gcaccatgga cctgcccttc cagaccccct tccaatcctc gggcctggac accagccgga ccacccggca ccatgggctg gtggacaggg tgtaccggga gcgtggccgg ctcggctccc cacaccgccg gcccctgtca gtggacaaac acggacggca ggccgacagc tgcccctatg gcaccatgta cctctcacca cccgcggaca ccagctggag aaggaccaat tctgactccg ccctgcacca gagcacaatg acgcccacgc agccagaatc ctttagcagt gggtcccagg acgtgcacca gaaaagagtc ttactgttaa cagtcccagg aatggaagag accacatcag aggcagacaa aaacctttcc aagcaagcat gggacaccaa gaagacgggg tccaggccca agtcctgtga ggtccccgga atcaacatct tcccgtctgc cgaccaggaa aacactacag ccctgatccc cgccacccac aacacagggg ggtccctgcc cgacctgacc aacatccact tcccctcccc gctcccgacc ccgctggacc ccgaggagcc caccttccct gcactgagca gctccagcag caccggcaac ctcgcggcca acctgacgca cctgggcatc ggtggcgccg gccagggaat gagcacacct ggctcctctc cacagcaccg cccagctggc gtcagccccc tgtccctgag cacagaggca aggcgtcagc aggcatcgcc cgccctgtcc ccgctgtcac ccatcactca ggctgtagcc atggacgccc tgtctctgga gcagcagctg ccctacgcct tcttcaccca ggcgggctcc cagcagccac cgccgcagcc ccagcccccg ccgcctcctc cacccgcgtc ccagcagcca ccacccccgc cacccccaca ggcgcccgtc cgcctgcccc ctggtggccc cctgttgccc agcgccagcc tgactcgtgg gccacagccg cccccgcttg cagtcacggt accgtcctct ctcccccagt cccccccaga gaaccctggc cagccatcga tggggatcga catcgcctcg gcgccggctc tgcagcagta ccgcactagc gccggctccc cggccaacca gtctcccacc tcgccagtct ccaatcaagg cttctcccca gggagctccc cgcaacacac ttccaccctg ggcagcgtgt ttggggacgc gtactatgag cagcagatgg cggccaggca ggccaatgct ctgtcccacc agctggagca gttcaacatg atggagaacg ccatcagctc cagcagcctg tacagcccgg gctccacact caactactcg caggcggcca tgatgggcct cacgggcagc cacgggagcc tgccggactc gcagcaactg ggatacgcca gccacagtgg catccccaac atcatcctca cagtgacagg agagtccccc cccagcctct ctaaagaact gaccagctct ctggccgggg tcggcgacgt cagcttcgac tccgacagcc agtttcccct ggacgaactc aagatcgacc ccctgaccct cgacggactg cacatgctca acgaccccga catggttctg gccgacccag ccaccgagga caccttccgg atggaccgcc tgtga. It is sometimes possible for the material contained within the vial of "CRTC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.