Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CORO1A cdna clone

CORO1A cDNA Clone

Gene Names
CORO1A; p57; IMD8; TACO; CLABP; HCORO1; CLIPINA
Synonyms
CORO1A; CORO1A cDNA Clone; CORO1A cdna clone
Ordering
For Research Use Only!
Sequence
atgagccggcaggtggtccgctccagcaagttccgccacgtgtttggacagccggccaaggccgaccagtgctatgaagatgtgcgcgtctcacagaccacctgggacagtggcttctgtgctgtcaaccctaagtttgtggccctgatctgtgaggccagcgggggaggggccttcctggtgctgcccctgggcaagactggacgtgtggacaagaatgcgcccacggtctgtggccacacagcccctgtgctagacatcgcctggtgcccgcacaatgacaacgtcattgccagtggctccgaggactgcacagtcatggtgtgggagatcccggatgggggcctgatgctgcccctgcgggagcccgtcgtcaccctggagggccacaccaagcgtgtgggcattgtggcctggcacaccacagcccagaacgtgctgctcagtgcaggttgtgacaacgtgatcatggtgtgggacgtgggcactggggcggccatgctgacactgggcccagaggtgcacccagacacgatctacagtgtggactggagccgagatggaggcctcatttgtacctcctgccgtgacaagcgcgtgcgcatcatcgagccccgcaaaggcactgtcgtagctgagaaggaccgtccccacgaggggacccggcccgtgcgtgcagtgttcgtgtcggaggggaagatcctgaccacgggcttcagccgcatgagtgagcggcaggtggcgctgtgggacacaaagcacctggaggagccgctgtccctgcaggagctggacaccagcagcggtgtcctgctgcccttctttgaccctgacaccaacatcgtctacctctgtggcaagggtgacagctcaatccggtactttgagatcacttccgaggcccctttcctgcactatctctccatgttcagttccaaggagtcccagcggggcatgggctacatgcccaaacgtggcctggaggtgaacaagtgtgagatcgccaggttctacaagctgcacgagcggaggtgtgagcccattgccatgacagtgcctcgaaagtcggacctgttccaggaggacctgtacccacccaccgcagggcccgaccctgccctcacggctgaggagtggctggggggtcgggatgctgggcccctcctcatctccctcaaggatggctacgtacccccaaagagccgggagctgagggtcaaccggggcctggacaccgggcgcaggagggcagcaccagaggccagtggcactcccagctcggatgccgtgtctcggctggaggaggagatgcggaagctccaggccacggtgcaggagctccagaagcgcttggacaggctggaggagacagtccaggccaagtag
Sequence Length
1386
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,026 Da
NCBI Official Full Name
Homo sapiens coronin, actin binding protein, 1A, mRNA
NCBI Official Synonym Full Names
coronin 1A
NCBI Official Symbol
CORO1A
NCBI Official Synonym Symbols
p57; IMD8; TACO; CLABP; HCORO1; CLIPINA
NCBI Protein Information
coronin-1A
UniProt Protein Name
Coronin-1A
Protein Family
UniProt Gene Name
CORO1A
UniProt Synonym Gene Names
CORO1; Clipin-A; TACO
UniProt Entry Name
COR1A_HUMAN

NCBI Description

This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Alternative splicing results in multiple transcript variants. A related pseudogene has been defined on chromosome 16. [provided by RefSeq, Sep 2010]

Uniprot Description

coronin 1A: May be a crucial component of the cytoskeleton of highly motile cells, functioning both in the invagination of large pieces of plasma membrane, as well as in forming protrusions of the plasma membrane involved in cell locomotion. In mycobacteria- infected cells, its retention on the phagosomal membrane prevents fusion between phagosomes and lysosomes. Belongs to the WD repeat coronin family.

Protein type: Motility/polarity/chemotaxis; Cytoskeletal

Chromosomal Location of Human Ortholog: 16p11.2

Cellular Component: actin filament; cortical actin cytoskeleton; cytoplasm; immunological synapse; lamellipodium; membrane; nucleus; phagocytic cup; phagocytic vesicle; plasma membrane; protein complex

Molecular Function: actin binding; actin filament binding; actin monomer binding; cytoskeletal protein binding; myosin heavy chain binding; phosphoinositide 3-kinase binding; protein binding; protein C-terminus binding; protein homodimerization activity

Biological Process: actin cytoskeleton organization and biogenesis; cell-substrate adhesion; formation of immunological synapse; natural killer cell degranulation; negative regulation of actin nucleation; phagocytosis; phagolysosome formation; positive chemotaxis; regulation of actin cytoskeleton organization and biogenesis

Disease: Immunodeficiency 8

Research Articles on CORO1A

Similar Products

Product Notes

The CORO1A coro1a (Catalog #AAA1270042) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagccggc aggtggtccg ctccagcaag ttccgccacg tgtttggaca gccggccaag gccgaccagt gctatgaaga tgtgcgcgtc tcacagacca cctgggacag tggcttctgt gctgtcaacc ctaagtttgt ggccctgatc tgtgaggcca gcgggggagg ggccttcctg gtgctgcccc tgggcaagac tggacgtgtg gacaagaatg cgcccacggt ctgtggccac acagcccctg tgctagacat cgcctggtgc ccgcacaatg acaacgtcat tgccagtggc tccgaggact gcacagtcat ggtgtgggag atcccggatg ggggcctgat gctgcccctg cgggagcccg tcgtcaccct ggagggccac accaagcgtg tgggcattgt ggcctggcac accacagccc agaacgtgct gctcagtgca ggttgtgaca acgtgatcat ggtgtgggac gtgggcactg gggcggccat gctgacactg ggcccagagg tgcacccaga cacgatctac agtgtggact ggagccgaga tggaggcctc atttgtacct cctgccgtga caagcgcgtg cgcatcatcg agccccgcaa aggcactgtc gtagctgaga aggaccgtcc ccacgagggg acccggcccg tgcgtgcagt gttcgtgtcg gaggggaaga tcctgaccac gggcttcagc cgcatgagtg agcggcaggt ggcgctgtgg gacacaaagc acctggagga gccgctgtcc ctgcaggagc tggacaccag cagcggtgtc ctgctgccct tctttgaccc tgacaccaac atcgtctacc tctgtggcaa gggtgacagc tcaatccggt actttgagat cacttccgag gcccctttcc tgcactatct ctccatgttc agttccaagg agtcccagcg gggcatgggc tacatgccca aacgtggcct ggaggtgaac aagtgtgaga tcgccaggtt ctacaagctg cacgagcgga ggtgtgagcc cattgccatg acagtgcctc gaaagtcgga cctgttccag gaggacctgt acccacccac cgcagggccc gaccctgccc tcacggctga ggagtggctg gggggtcggg atgctgggcc cctcctcatc tccctcaagg atggctacgt acccccaaag agccgggagc tgagggtcaa ccggggcctg gacaccgggc gcaggagggc agcaccagag gccagtggca ctcccagctc ggatgccgtg tctcggctgg aggaggagat gcggaagctc caggccacgg tgcaggagct ccagaagcgc ttggacaggc tggaggagac agtccaggcc aagtag. It is sometimes possible for the material contained within the vial of "CORO1A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.