EGR1 cdna clone
EGR1 cDNA Clone
Gene Names
EGR1; TIS8; AT225; G0S30; NGFI-A; ZNF225; KROX-24; ZIF-268
Synonyms
EGR1; EGR1 cDNA Clone; EGR1 cdna clone
Sequence
atggccgcggccaaggccgagatgcagctgatgtccccgctgcagatctctgacccgttcggatcctttcctcactcgcccaccatggacaactaccctaagctggaggagatgatgctgctgagcaacggggctccccagttcctcggcgccgccggggccccagagggcagcggcagcaacagcagcagcagcagcagcgggggcggtggaggcggcgggggcggcagcaacagcagcagcagcagcagcaccttcaaccctcaggcggacacgggcgagcagccctacgagcacctgaccgcagagtcttttcctgacatctctctgaacaacgagaaggtgctggtggagaccagttaccccagccaaaccactcgactgccccccatcacctatactggccgcttttccctggagcctgcacccaacagtggcaacaccttgtggcccgagcccctcttcagcttggtcagtggcctagtgagcatgaccaacccaccggcctcctcgtcctcagcaccatctccagcggcctcctccgcctccgcctcccagagcccacccctgagctgcgcagtgccatccaacgacagcagtcccatttactcagcggcacccaccttccccacgccgaacactgacattttccctgagccacaaagccaggccttcccgggctcggcagggacagcgctccagtacccgcctcctgcctaccctgccgccaagggtggcttccaggttcccatgatccccgactacctgtttccacagcagcagggggatctgggcctgggcaccccagaccagaagcccttccagggcctggagagccgcacccagcagccttcgctaacccctctgtctactattaaggcctttgccactcagtcgggctcccaggacctgaaggccctcaataccagctaccagtcccagctcatcaaacccagccgcatgcgcaagtaccccaaccggcccagcaagacgcccccccacgaacgcccttacgcttgcccagtggagtcctgtgatcgccgcttctcccgctccgacgagctcacccgccacatccgcatccacacaggccagaagcccttccagtgccgcatctgcatgcgcaacttcagccgcagcgaccacctcaccacccacatccgcacccacacaggcgaaaagcccttcgcctgcgacatctgtggaagaaagtttgccaggagcgatgaacgcaagaggcataccaagatccacttgcggcagaaggacaagaaagcagacaaaagtgttgtggcctcttcggccacctcctctctctcttcctacccgtccccggttgctacctcttacccgtccccggttactacctcttatccatccccggccaccacctcatacccatcccctgtgcccacctccttctcctctcccggctcctcgacctacccatcccctgtgcacagtggcttcccctccccgtcggtggccaccacgtactcctctgttccccctgctttcccggcccaggtcagcagcttcccttcctcagctgtcaccaactccttcagcgcctccacagggctttcggacatgacagcaaccttttctcccaggacaattgaaatttgctaa
Sequence Length
1632
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
57,507 Da
NCBI Official Full Name
Homo sapiens early growth response 1, mRNA
NCBI Official Synonym Full Names
early growth response 1
NCBI Official Symbol
EGR1
NCBI Official Synonym Symbols
TIS8; AT225; G0S30; NGFI-A; ZNF225; KROX-24; ZIF-268
NCBI Protein Information
early growth response protein 1
UniProt Protein Name
Early growth response protein 1
Protein Family
UniProt Gene Name
EGR1
UniProt Synonym Gene Names
KROX24; ZNF225; EGR-1; NGFI-A
UniProt Entry Name
EGR1_HUMAN
NCBI Description
The protein encoded by this gene belongs to the EGR family of C2H2-type zinc-finger proteins. It is a nuclear protein and functions as a transcriptional regulator. The products of target genes it activates are required for differentitation and mitogenesis. Studies suggest this is a cancer suppressor gene. [provided by RefSeq, Dec 2014]
Uniprot Description
EGR1: Transcriptional regulator. Recognizes and binds to the DNA sequence 5'-CGCCCCCGC-3'(EGR-site). Activates the transcription of target genes whose products are required for mitogenesis and differentiation. By growth factors. Belongs to the EGR C2H2-type zinc-finger protein family.
Protein type: C2H2-type zinc finger protein; Transcription factor; DNA-binding
Chromosomal Location of Human Ortholog: 5q31.1
Cellular Component: cytoplasm; nucleoplasm; nucleus
Molecular Function: DNA binding; histone acetyltransferase binding; protein binding; sequence-specific DNA binding; transcription factor activity
Biological Process: positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; regulation of protein sumoylation; transcription from RNA polymerase II promoter
Research Articles on EGR1
Similar Products
Product Notes
The EGR1 egr1 (Catalog #AAA1270030) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgcgg ccaaggccga gatgcagctg atgtccccgc tgcagatctc tgacccgttc ggatcctttc ctcactcgcc caccatggac aactacccta agctggagga gatgatgctg ctgagcaacg gggctcccca gttcctcggc gccgccgggg ccccagaggg cagcggcagc aacagcagca gcagcagcag cgggggcggt ggaggcggcg ggggcggcag caacagcagc agcagcagca gcaccttcaa ccctcaggcg gacacgggcg agcagcccta cgagcacctg accgcagagt cttttcctga catctctctg aacaacgaga aggtgctggt ggagaccagt taccccagcc aaaccactcg actgcccccc atcacctata ctggccgctt ttccctggag cctgcaccca acagtggcaa caccttgtgg cccgagcccc tcttcagctt ggtcagtggc ctagtgagca tgaccaaccc accggcctcc tcgtcctcag caccatctcc agcggcctcc tccgcctccg cctcccagag cccacccctg agctgcgcag tgccatccaa cgacagcagt cccatttact cagcggcacc caccttcccc acgccgaaca ctgacatttt ccctgagcca caaagccagg ccttcccggg ctcggcaggg acagcgctcc agtacccgcc tcctgcctac cctgccgcca agggtggctt ccaggttccc atgatccccg actacctgtt tccacagcag cagggggatc tgggcctggg caccccagac cagaagccct tccagggcct ggagagccgc acccagcagc cttcgctaac ccctctgtct actattaagg cctttgccac tcagtcgggc tcccaggacc tgaaggccct caataccagc taccagtccc agctcatcaa acccagccgc atgcgcaagt accccaaccg gcccagcaag acgccccccc acgaacgccc ttacgcttgc ccagtggagt cctgtgatcg ccgcttctcc cgctccgacg agctcacccg ccacatccgc atccacacag gccagaagcc cttccagtgc cgcatctgca tgcgcaactt cagccgcagc gaccacctca ccacccacat ccgcacccac acaggcgaaa agcccttcgc ctgcgacatc tgtggaagaa agtttgccag gagcgatgaa cgcaagaggc ataccaagat ccacttgcgg cagaaggaca agaaagcaga caaaagtgtt gtggcctctt cggccacctc ctctctctct tcctacccgt ccccggttgc tacctcttac ccgtccccgg ttactacctc ttatccatcc ccggccacca cctcataccc atcccctgtg cccacctcct tctcctctcc cggctcctcg acctacccat cccctgtgca cagtggcttc ccctccccgt cggtggccac cacgtactcc tctgttcccc ctgctttccc ggcccaggtc agcagcttcc cttcctcagc tgtcaccaac tccttcagcg cctccacagg gctttcggac atgacagcaa ccttttctcc caggacaatt gaaatttgct aa. It is sometimes possible for the material contained within the vial of "EGR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
