ZNF317 cdna clone
ZNF317 cDNA Clone
Synonyms
ZNF317; ZNF317 cDNA Clone; ZNF317 cdna clone
Sequence
atggcagctctgtcccccacatttgccacgtccacccaggattccacctgtctccaggactcagaatttcctgtttcttcaaaagaccattcctgtccccagaatttggacctgttcgtgtgcagtggtctggagcctcacacacccagtgttggttcccaggaatcggtgactttccaagatgtcgctgtggactttaccgagaaggagtggcccttgctggattcttctcagagaaaactgtacaaagatgtaatgctggagaactacagcaacctcacttcactggggtatcaggtcggcaaacccagcctcatctcacacttggagcaggaggaggagccgaggacagaggagaggggcgctcaccagggcgcttgtgcagattgggagactccatctaaaaccaagtggtcacttcttatggaagatatttttgggaaggaaacgcccagtggtgtgacgatggaaagagccggtcttggagagaagtccactgaatacgctcacttgttcgaagtctttggcatggaccctcatctcactcagccaatgggaaggcacgctggcaagaggccctatcaccgccgcgactatggggtagcgttcaagggcaggccgcacctcactcagcacatgagcatgtacgacgggagaaaaatgcatgaatgtcatcagtgccaaaaagccttcaccacgagcgcgtccctcacacggcacaggagaatccacaccggggagaagccttacgagtgcagcgactgcgggaaagccttcaacgacccttcagcccttaggagccacgcaagaactcacctcaaagagaagccctttgactgcagtcagtgtggaaatgcattccggaccctctcggccctgaaaatccacatgcgagttcacactggcgagaggccttacaagtgtgatcagtgcgggaaggcttacggccggagctgccacctcatcgcacacaagagaacgcacaccggagagaggccctacgagtgtcacgactgtgggaaagctttccagcacccctcccacctcaaagagcacgtgaggaatcacacgggggagaagccctacgcgtgcacgcagtgcggcaaagccttccgctggaagtccaactttaatttgcacaagaagaaccacatggtggagaagacctacgaatgtaaagaatgcgggaaatcctttggcgatctcgtgtcccggaggaaacacatgaggattcacatcgtcaagaaacccgtggaatgtcggcagtgcgggaagaccttccgaaaccagtccatccttaagactcacatgaactctcacactggagagaaaccatacgggtgcgatctctgcgggaaagctttcagcgcgagttcaaacctcaccgcacacaggaagatacacacgcaagagagacgctacgaatgcgccgcctgcgggaaagtcttcggtgactatttatcccggcggaggcacatgagcgttcaccttgtaaagaaacgagttgagtgtaggcagtgtggcaaggccttcaggaaccagtcaacgctgaagacgcacatgcgaagccacacgggggagaaaccgtacgaatgcgatcactgtgggaaggccttcagcataggctccaacctgaatgtgcacaggcggatccacaccggggagaagccctacgaatgccttgtctgcgggaaagccttcagcgaccactcatccctcaggagccacgtgaaaactcaccggggagagaagctctttgtgtcatccgtgtggaaaaggctccagtga
Sequence Length
1788
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
58,621 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 317, mRNA
NCBI Official Synonym Full Names
zinc finger protein 317
NCBI Official Symbol
ZNF317
NCBI Protein Information
zinc finger protein 317
UniProt Protein Name
Zinc finger protein 317
Protein Family
UniProt Gene Name
ZNF317
UniProt Synonym Gene Names
KIAA1588
UniProt Entry Name
ZN317_HUMAN
Uniprot Description
ZNF317: May function as a transcription factor. May play an important role in erythroid maturation and lymphoid proliferation. Belongs to the krueppel C2H2-type zinc-finger protein family. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: C2H2-type zinc finger protein; DNA-binding
Chromosomal Location of Human Ortholog: 19p13
Cellular Component: nucleus
Molecular Function: protein binding; transcription factor activity
Biological Process: regulation of transcription, DNA-dependent
Research Articles on ZNF317
Similar Products
Product Notes
The ZNF317 znf317 (Catalog #AAA1270028) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagctc tgtcccccac atttgccacg tccacccagg attccacctg tctccaggac tcagaatttc ctgtttcttc aaaagaccat tcctgtcccc agaatttgga cctgttcgtg tgcagtggtc tggagcctca cacacccagt gttggttccc aggaatcggt gactttccaa gatgtcgctg tggactttac cgagaaggag tggcccttgc tggattcttc tcagagaaaa ctgtacaaag atgtaatgct ggagaactac agcaacctca cttcactggg gtatcaggtc ggcaaaccca gcctcatctc acacttggag caggaggagg agccgaggac agaggagagg ggcgctcacc agggcgcttg tgcagattgg gagactccat ctaaaaccaa gtggtcactt cttatggaag atatttttgg gaaggaaacg cccagtggtg tgacgatgga aagagccggt cttggagaga agtccactga atacgctcac ttgttcgaag tctttggcat ggaccctcat ctcactcagc caatgggaag gcacgctggc aagaggccct atcaccgccg cgactatggg gtagcgttca agggcaggcc gcacctcact cagcacatga gcatgtacga cgggagaaaa atgcatgaat gtcatcagtg ccaaaaagcc ttcaccacga gcgcgtccct cacacggcac aggagaatcc acaccgggga gaagccttac gagtgcagcg actgcgggaa agccttcaac gacccttcag cccttaggag ccacgcaaga actcacctca aagagaagcc ctttgactgc agtcagtgtg gaaatgcatt ccggaccctc tcggccctga aaatccacat gcgagttcac actggcgaga ggccttacaa gtgtgatcag tgcgggaagg cttacggccg gagctgccac ctcatcgcac acaagagaac gcacaccgga gagaggccct acgagtgtca cgactgtggg aaagctttcc agcacccctc ccacctcaaa gagcacgtga ggaatcacac gggggagaag ccctacgcgt gcacgcagtg cggcaaagcc ttccgctgga agtccaactt taatttgcac aagaagaacc acatggtgga gaagacctac gaatgtaaag aatgcgggaa atcctttggc gatctcgtgt cccggaggaa acacatgagg attcacatcg tcaagaaacc cgtggaatgt cggcagtgcg ggaagacctt ccgaaaccag tccatcctta agactcacat gaactctcac actggagaga aaccatacgg gtgcgatctc tgcgggaaag ctttcagcgc gagttcaaac ctcaccgcac acaggaagat acacacgcaa gagagacgct acgaatgcgc cgcctgcggg aaagtcttcg gtgactattt atcccggcgg aggcacatga gcgttcacct tgtaaagaaa cgagttgagt gtaggcagtg tggcaaggcc ttcaggaacc agtcaacgct gaagacgcac atgcgaagcc acacggggga gaaaccgtac gaatgcgatc actgtgggaa ggccttcagc ataggctcca acctgaatgt gcacaggcgg atccacaccg gggagaagcc ctacgaatgc cttgtctgcg ggaaagcctt cagcgaccac tcatccctca ggagccacgt gaaaactcac cggggagaga agctctttgt gtcatccgtg tggaaaaggc tccagtga. It is sometimes possible for the material contained within the vial of "ZNF317, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
