Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CMBL cdna clone

CMBL cDNA Clone

Gene Names
CMBL; JS-1
Synonyms
CMBL; CMBL cDNA Clone; CMBL cdna clone
Ordering
For Research Use Only!
Sequence
atggctaacgaagcttatccttgtccgtgtgacattggccacagacttgagtatggagggctaggccgtgaagttcaagtcgagcacatcaaggcttatgtcaccaaatcccccgttgatgcaggcaaagctgtgattgtcattcaagatatatttggctggcagttgcccaataccagatatatagctgacatgatctcaggaaatggatacacaaccattgttccagacttctttgtagggcaagagccttgggacccctctggcgactggtctatcttccctgagtggctgaaaacaagaaatgcccagaagatcgatagagagatcagtgctatcttgaagtatctgaaacaacagtgtcatgcccagaaaattggcatcgtgggattctgctggggtggaactgctgtccatcatttgatgatgaaatactcagaattcagggcaggggtgtccgtctatggcattgtcaaggattctgaagacatttacaatttaaagaaccccactttgttcatttttgctgaaaatgatgttgtgattccactcaaggacgtatctttgctgactcagaagttgaaagaacactgcaaagttgaatatcaaattaaaacattttctgggcagactcatgggttcgtgcatcggaagagagaagattgctcacctgcagacaagccctacattgacgaggccagaaggaatttaattgagtggctgaacaagtacatgtag
Sequence Length
738
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,048 Da
NCBI Official Full Name
Homo sapiens carboxymethylenebutenolidase homolog (Pseudomonas), mRNA
NCBI Official Synonym Full Names
carboxymethylenebutenolidase homolog
NCBI Official Symbol
CMBL
NCBI Official Synonym Symbols
JS-1
NCBI Protein Information
carboxymethylenebutenolidase homolog
UniProt Protein Name
Carboxymethylenebutenolidase homolog
UniProt Gene Name
CMBL
UniProt Entry Name
CMBL_HUMAN

NCBI Description

CMBL (EC 3.1.1.45) is a cysteine hydrolase of the dienelactone hydrolase family that is highly expressed in liver cytosol. CMBL preferentially cleaves cyclic esters, and it activates medoxomil-ester prodrugs in which the medoxomil moiety is linked to an oxygen atom (Ishizuka et al., 2010 [PubMed 20177059]).[supplied by OMIM, Apr 2010]

Uniprot Description

CMBL: Cysteine hydrolase. Can convert the prodrug olmesartan medoxomil into its pharmacologically active metabolite olmerstatan, an angiotensin receptor blocker, in liver and intestine. May also activate beta-lactam antibiotics faropenem medoxomil and lenampicillin. Belongs to the dienelactone hydrolase family.

Protein type: EC 3.1.-.-; Hydrolase

Chromosomal Location of Human Ortholog: 5p15.2

Cellular Component: cytosol

Molecular Function: hydrolase activity

Biological Process: xenobiotic metabolic process

Research Articles on CMBL

Similar Products

Product Notes

The CMBL cmbl (Catalog #AAA1270007) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctaacg aagcttatcc ttgtccgtgt gacattggcc acagacttga gtatggaggg ctaggccgtg aagttcaagt cgagcacatc aaggcttatg tcaccaaatc ccccgttgat gcaggcaaag ctgtgattgt cattcaagat atatttggct ggcagttgcc caataccaga tatatagctg acatgatctc aggaaatgga tacacaacca ttgttccaga cttctttgta gggcaagagc cttgggaccc ctctggcgac tggtctatct tccctgagtg gctgaaaaca agaaatgccc agaagatcga tagagagatc agtgctatct tgaagtatct gaaacaacag tgtcatgccc agaaaattgg catcgtggga ttctgctggg gtggaactgc tgtccatcat ttgatgatga aatactcaga attcagggca ggggtgtccg tctatggcat tgtcaaggat tctgaagaca tttacaattt aaagaacccc actttgttca tttttgctga aaatgatgtt gtgattccac tcaaggacgt atctttgctg actcagaagt tgaaagaaca ctgcaaagtt gaatatcaaa ttaaaacatt ttctgggcag actcatgggt tcgtgcatcg gaagagagaa gattgctcac ctgcagacaa gccctacatt gacgaggcca gaaggaattt aattgagtgg ctgaacaagt acatgtag. It is sometimes possible for the material contained within the vial of "CMBL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.