TRIM47 cdna clone
TRIM47 cDNA Clone
Gene Names
TRIM47; GOA; RNF100
Synonyms
TRIM47; TRIM47 cDNA Clone; TRIM47 cdna clone
Sequence
atggacgagctgggtgctggcattgcacagtccaggcgcacagtggccctcatcaagagtgcagccgtagcagagcgggagagggtgagccggctgtttgcagatgctgcggccgccctgcagggcttccagacccaggtgctgggcttcatcgaggagggggaagctgccatgctaggccgctcccagggtgacctgcggcgacaggaggaacagcgcagccgcctgagccgagcccgccagaatctcagccaggtccctgaagctgactcagtcagcttcctgcaggagctgctggcactaaggctggccctggaggatgggtgtggccctgggcctggacccccgagggagctcagcttcaccaaatcatcccaagctgtccgtgcagtgagagacatgctggccgtggcctgcgtcaaccagtgggagcagctgagggggccgggtggcaacgaggatgggccacagaagctggactcggaagctgatgctgagccccaagacctcgagagtacgaacctcttggagagtgaagctcccagggactatttcctcaagtttgcctatattgtggatttggacagcgacacagcagacaagttcctgcagctgtttggaaccaaaggtgtcaagagggtgctgtgtcctatcaactaccccttgtcgcccacccgcttcacccattgtgagcaggtgctgggcgagggtgccctggaccgaggcacctactactgggaggtggagattatcgagggctgggtcagcatgggggtcatggccgaagacttctccccacaagagccctacgaccgcggccggctgggccgcaacgcccactcctgctgcctgcagtggaatggacgcagcttctccgtctggtttcatgggctggaggctcccctgccccaccccttctcgcccacggttggggtctgcctggaatacgctgaccgtgccttggccttctatgctgtacgggacggcaagatgagcctcctgcggaggctgaaggcctcccggccccgccggggtggcatcccggcctcccccattgaccccttccagagccgcctggacagtcactttgcggggctcttcacccacagactcaagcctgccttcttcctggagagtgtggacgcccacttgcagatcgggcccctcaagaagtcctgcatatccgtgctgaagaggaggtga
Sequence Length
1203
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
44,410 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 47, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 47
NCBI Official Symbol
TRIM47
NCBI Official Synonym Symbols
GOA; RNF100
NCBI Protein Information
tripartite motif-containing protein 47
UniProt Protein Name
Tripartite motif-containing protein 47
Protein Family
UniProt Gene Name
TRIM47
UniProt Synonym Gene Names
GOA; RNF100
UniProt Entry Name
TRI47_HUMAN
Uniprot Description
TRIM47: Belongs to the TRIM/RBCC family.
Protein type: Ubiquitin conjugating system
Chromosomal Location of Human Ortholog: 17q25
Cellular Component: cytoplasm
Similar Products
Product Notes
The TRIM47 trim47 (Catalog #AAA1269928) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgagc tgggtgctgg cattgcacag tccaggcgca cagtggccct catcaagagt gcagccgtag cagagcggga gagggtgagc cggctgtttg cagatgctgc ggccgccctg cagggcttcc agacccaggt gctgggcttc atcgaggagg gggaagctgc catgctaggc cgctcccagg gtgacctgcg gcgacaggag gaacagcgca gccgcctgag ccgagcccgc cagaatctca gccaggtccc tgaagctgac tcagtcagct tcctgcagga gctgctggca ctaaggctgg ccctggagga tgggtgtggc cctgggcctg gacccccgag ggagctcagc ttcaccaaat catcccaagc tgtccgtgca gtgagagaca tgctggccgt ggcctgcgtc aaccagtggg agcagctgag ggggccgggt ggcaacgagg atgggccaca gaagctggac tcggaagctg atgctgagcc ccaagacctc gagagtacga acctcttgga gagtgaagct cccagggact atttcctcaa gtttgcctat attgtggatt tggacagcga cacagcagac aagttcctgc agctgtttgg aaccaaaggt gtcaagaggg tgctgtgtcc tatcaactac cccttgtcgc ccacccgctt cacccattgt gagcaggtgc tgggcgaggg tgccctggac cgaggcacct actactggga ggtggagatt atcgagggct gggtcagcat gggggtcatg gccgaagact tctccccaca agagccctac gaccgcggcc ggctgggccg caacgcccac tcctgctgcc tgcagtggaa tggacgcagc ttctccgtct ggtttcatgg gctggaggct cccctgcccc accccttctc gcccacggtt ggggtctgcc tggaatacgc tgaccgtgcc ttggccttct atgctgtacg ggacggcaag atgagcctcc tgcggaggct gaaggcctcc cggccccgcc ggggtggcat cccggcctcc cccattgacc ccttccagag ccgcctggac agtcactttg cggggctctt cacccacaga ctcaagcctg ccttcttcct ggagagtgtg gacgcccact tgcagatcgg gcccctcaag aagtcctgca tatccgtgct gaagaggagg tga. It is sometimes possible for the material contained within the vial of "TRIM47, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
