Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PIAS3 cdna clone

PIAS3 cDNA Clone

Gene Names
PIAS3; ZMIZ5
Synonyms
PIAS3; PIAS3 cDNA Clone; PIAS3 cdna clone
Ordering
For Research Use Only!
Sequence
atggtgatgagtttccgggtgtctgagctccaggtgcttcttggctttgctggccggaacaagagtggacggaagcacgagctcctggccaaggctctgcacctcctgaagtccagctgtgcccctagtgtccagatgaagatcaaagagctttaccgacgacgctttccccggaagaccctggggccctctgatctctcccttctctctttgccccctggcacctctcctgtaggctcccctggtcctctagctcccattcccccaacgctgttggcccctggcaccctgctgggccccaagcgtgaggtggacatgcacccccctctgccccagcctgtgcaccctgatgtcaccatgaaaccattgcccttctatgaagtctatggggagctcatccggcccaccacccttgcatccacttctagccagcggtttgaggaagcgcactttacctttgccctcacaccccagcaagtgcagcagattcttacatccagagaggttctgccaggagccaaatgtgattataccatacaggtgcagctaaggttctgtctctgtgagaccagctgcccccaggaagattattttccccccaacctctttgtcaaggtcaatgggaaactgtgccccctgccgggttaccttcccccaaccaagaatggggccgagcccaagaggcccagccgccccatcaacatcacacccctggctcgactctcagccactgttcccaacaccattgtggtcaattggtcatctgagttcggacggaattactccttgtctgtgtacctggtgaggcagttgactgcaggaacccttctacaaaaactcagagcaaagggtatccggaacccagaccactcgcgggcactgatcaaggagaaattgactgctgaccctgacagtgaggtggccactacaagtctccgggtgtcactcatgtgcccgctagggaagatgcgcctgactgtcccttgtcgtgccctcacctgcgcccacctgcagagcttcgatgctgccctttatctacagatgaatgagaagaagcctacatggacatgtcctgtgtgtgacaagaaggctccctatgaatctcttatcattgatggtttatttatggagattcttagttcctgttcagattgtgatgagatccaattcatggaagatggatcctggtgcccaatgaaacccaagaaggaggcatctgaggtttgccccccgccagggtatgggctggatggcctccagtacagcccagtccaggggggagatccatcagagaataagaagaaggtcgaagttattgacttgacaatagaaagctcatcagatgaggaggatctgccccctaccaagaagcactgttctgtcacctcagctgccatcccggccctacctggaagcaaaggagtcctgacatctggccaccagccatcctcggtgctaaggagccctgctatgggcacgttgggtggggatttcctgtccagtctcccactacatgagtacccacctgccttcccactgggagccgacatccaaggtttagatttattttcatttcttcagacagagagtcagcactatggcccctctgtcatcacctcactagatgaacaggatgcccttggccacttcttccagtaccgagggaccccttctcactttctgggcccactggcccccacgctggggagctcccactgcagcgccactccggcgccccctcctggccgtgtcagcagcattgtggcccctgggggggccttgagggaggggcatggaggacccctgccctcaggtccctctttgactggctgtcggtcagacatcatttccctggactga
Sequence Length
1860
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
68,017 Da
NCBI Official Full Name
Homo sapiens protein inhibitor of activated STAT, 3, mRNA
NCBI Official Synonym Full Names
protein inhibitor of activated STAT 3
NCBI Official Symbol
PIAS3
NCBI Official Synonym Symbols
ZMIZ5
NCBI Protein Information
E3 SUMO-protein ligase PIAS3
UniProt Protein Name
E3 SUMO-protein ligase PIAS3
Protein Family
UniProt Gene Name
PIAS3
UniProt Entry Name
PIAS3_HUMAN

NCBI Description

This gene encodes a member of the PIAS [protein inhibitor of activated STAT (signal transducer and activator of transcription)] family of transcriptional modulators. The protein functions as a SUMO (small ubiquitin-like modifier)-E3 ligase which catalyzes the covalent attachment of a SUMO protein to specific target substrates. It directly binds to several transcription factors and either blocks or enhances their activity. Alternatively spliced transcript variants of this gene have been identified, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

PIAS3: Functions as an E3-type small ubiquitin-like modifier (SUMO) ligase, stabilizing the interaction between UBE2I and the substrate, and as a SUMO-tethering factor. Plays a crucial role as a transcriptional coregulation in various cellular pathways, including the STAT pathway and the steroid hormone signaling pathway. Involved in regulating STAT3 signaling via inhibiting STAT3 DNA-binding and suppressing cell growth. Monomer. Binds SUMO1 and UBE2I. Interacts with BCL11A, HMGA2, IRF1, MITF and NCOA2. Interacts with STAT5; the interaction occurs on stimulation by PRL. Interacts with GFI1; the interaction relieves the inhibitory effect of PIAS3 on STAT3- mediated transcriptional activity. Interacts with AR, PLAG1 and ZFHX3. Interacts with STAT3; the interaction occurs on stimulation by IL6, CNTF or OSM and inhibits the DNA binding activity of STAT3. By dihydrotestosterone (DHT) in prostate cancer cells. Isoform 1 is expressed in most tissues except thymus and small intestine. Isoform 3 is expressed only in brain, heart, thymus, muscle, lung, testis, lactating breast and embryonic stem cells. Belongs to the PIAS family.

Protein type: SUMO conjugating system; Nuclear receptor co-regulator; EC 6.3.2.-

Chromosomal Location of Human Ortholog: 1q21

Cellular Component: nucleoplasm

Molecular Function: enzyme binding; protein binding; protein C-terminus binding; SUMO ligase activity

Biological Process: negative regulation of protein sumoylation; positive regulation of protein sumoylation; protein sumoylation

Research Articles on PIAS3

Similar Products

Product Notes

The PIAS3 pias3 (Catalog #AAA1269910) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgatga gtttccgggt gtctgagctc caggtgcttc ttggctttgc tggccggaac aagagtggac ggaagcacga gctcctggcc aaggctctgc acctcctgaa gtccagctgt gcccctagtg tccagatgaa gatcaaagag ctttaccgac gacgctttcc ccggaagacc ctggggccct ctgatctctc ccttctctct ttgccccctg gcacctctcc tgtaggctcc cctggtcctc tagctcccat tcccccaacg ctgttggccc ctggcaccct gctgggcccc aagcgtgagg tggacatgca cccccctctg ccccagcctg tgcaccctga tgtcaccatg aaaccattgc ccttctatga agtctatggg gagctcatcc ggcccaccac ccttgcatcc acttctagcc agcggtttga ggaagcgcac tttacctttg ccctcacacc ccagcaagtg cagcagattc ttacatccag agaggttctg ccaggagcca aatgtgatta taccatacag gtgcagctaa ggttctgtct ctgtgagacc agctgccccc aggaagatta ttttcccccc aacctctttg tcaaggtcaa tgggaaactg tgccccctgc cgggttacct tcccccaacc aagaatgggg ccgagcccaa gaggcccagc cgccccatca acatcacacc cctggctcga ctctcagcca ctgttcccaa caccattgtg gtcaattggt catctgagtt cggacggaat tactccttgt ctgtgtacct ggtgaggcag ttgactgcag gaacccttct acaaaaactc agagcaaagg gtatccggaa cccagaccac tcgcgggcac tgatcaagga gaaattgact gctgaccctg acagtgaggt ggccactaca agtctccggg tgtcactcat gtgcccgcta gggaagatgc gcctgactgt cccttgtcgt gccctcacct gcgcccacct gcagagcttc gatgctgccc tttatctaca gatgaatgag aagaagccta catggacatg tcctgtgtgt gacaagaagg ctccctatga atctcttatc attgatggtt tatttatgga gattcttagt tcctgttcag attgtgatga gatccaattc atggaagatg gatcctggtg cccaatgaaa cccaagaagg aggcatctga ggtttgcccc ccgccagggt atgggctgga tggcctccag tacagcccag tccagggggg agatccatca gagaataaga agaaggtcga agttattgac ttgacaatag aaagctcatc agatgaggag gatctgcccc ctaccaagaa gcactgttct gtcacctcag ctgccatccc ggccctacct ggaagcaaag gagtcctgac atctggccac cagccatcct cggtgctaag gagccctgct atgggcacgt tgggtgggga tttcctgtcc agtctcccac tacatgagta cccacctgcc ttcccactgg gagccgacat ccaaggttta gatttatttt catttcttca gacagagagt cagcactatg gcccctctgt catcacctca ctagatgaac aggatgccct tggccacttc ttccagtacc gagggacccc ttctcacttt ctgggcccac tggcccccac gctggggagc tcccactgca gcgccactcc ggcgccccct cctggccgtg tcagcagcat tgtggcccct gggggggcct tgagggaggg gcatggagga cccctgccct caggtccctc tttgactggc tgtcggtcag acatcatttc cctggactga. It is sometimes possible for the material contained within the vial of "PIAS3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.