Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

COX11 cdna clone

COX11 cDNA Clone

Gene Names
COX11; COX11P
Synonyms
COX11; COX11 cDNA Clone; COX11 cdna clone
Ordering
For Research Use Only!
Sequence
atgggagggctctggcgtcctggatggaggtgcgttcctttctgtggctggcgctggatccaccctgggtctccaaccagggctgcagagagggtagagccgtttcttaggccagagtggagtgggacaggaggtgccgagagaggactgaggtggcttgggacatggaagcgctgcagccttcgagcccggcatccagcattgcagccgccgcggcggcctaagagctcgaaccctttcacacgcgcgcaggaggaggagcggcggcggcagaacaagacgaccctcacttacgtggccgctgtcgccgtgggcatgctgggggcgtcctacgctgccgtacccctttatcggctctattgccagactactggacttggaggatcagcagttgcaggtcatgcctcagacaagattgaaaacatggtgcctgttaaagatcgaatcattaaaattagctttaatgcagatgtgcatgcaagtctccagtggaactttagacctcagcaaacagaaatatatgtggtgccaggagagactgcactggcgttttacagagttaagaatcctactgacaaaccagtaattggaatttctacatacaatattgttccatttgaagctggacagtatttcaataaaatacagtgcttctgttttgaagaacaaaggcttaatccccaagaggaagtagatatgccagtgtttttctacattgatcctgaatttgctgaagatccaagaatgattaaagttgatcttatcactctttcttacactttttttgaagcaaaggaagggcacaagttgccagttccaggatataattga
Sequence Length
831
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,133 Da
NCBI Official Full Name
Homo sapiens COX11 homolog, cytochrome c oxidase assembly protein (yeast), mRNA
NCBI Official Synonym Full Names
COX11, cytochrome c oxidase copper chaperone
NCBI Official Symbol
COX11
NCBI Official Synonym Symbols
COX11P
NCBI Protein Information
cytochrome c oxidase assembly protein COX11, mitochondrial
UniProt Protein Name
Cytochrome c oxidase assembly protein COX11, mitochondrial
UniProt Gene Name
COX11
UniProt Entry Name
COX11_HUMAN

NCBI Description

Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein which is not a structural subunit, but may be a heme A biosynthetic enzyme involved in COX formation, according to the yeast mutant studies. However, the studies in Rhodobacter sphaeroides suggest that this gene is not required for heme A biosynthesis, but required for stable formation of the Cu(B) and magnesium centers of COX. This human protein is predicted to contain a transmembrane domain localized in the mitochondrial inner membrane. Multiple transcript variants encoding different isoforms have been found for this gene. A related pseudogene has been found on chromosome 6. [provided by RefSeq, Jun 2009]

Uniprot Description

COX11: Exerts its effect at some terminal stage of cytochrome c oxidase synthesis, probably by being involved in the insertion of the copper B into subunit I. Belongs to the COX11/CtaG family.

Protein type: Mitochondrial; Energy Metabolism - oxidative phosphorylation; Oxidoreductase; Membrane protein, integral

Chromosomal Location of Human Ortholog: 17q22

Cellular Component: mitochondrion

Molecular Function: copper ion binding; cytochrome-c oxidase activity; electron carrier activity

Biological Process: aerobic respiration; respiratory chain complex IV assembly; respiratory gaseous exchange

Research Articles on COX11

Similar Products

Product Notes

The COX11 cox11 (Catalog #AAA1269865) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggagggc tctggcgtcc tggatggagg tgcgttcctt tctgtggctg gcgctggatc caccctgggt ctccaaccag ggctgcagag agggtagagc cgtttcttag gccagagtgg agtgggacag gaggtgccga gagaggactg aggtggcttg ggacatggaa gcgctgcagc cttcgagccc ggcatccagc attgcagccg ccgcggcggc ctaagagctc gaaccctttc acacgcgcgc aggaggagga gcggcggcgg cagaacaaga cgaccctcac ttacgtggcc gctgtcgccg tgggcatgct gggggcgtcc tacgctgccg taccccttta tcggctctat tgccagacta ctggacttgg aggatcagca gttgcaggtc atgcctcaga caagattgaa aacatggtgc ctgttaaaga tcgaatcatt aaaattagct ttaatgcaga tgtgcatgca agtctccagt ggaactttag acctcagcaa acagaaatat atgtggtgcc aggagagact gcactggcgt tttacagagt taagaatcct actgacaaac cagtaattgg aatttctaca tacaatattg ttccatttga agctggacag tatttcaata aaatacagtg cttctgtttt gaagaacaaa ggcttaatcc ccaagaggaa gtagatatgc cagtgttttt ctacattgat cctgaatttg ctgaagatcc aagaatgatt aaagttgatc ttatcactct ttcttacact ttttttgaag caaaggaagg gcacaagttg ccagttccag gatataattg a. It is sometimes possible for the material contained within the vial of "COX11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.