MTF2 cdna clone
MTF2 cDNA Clone
Gene Names
MTF2; M96; PCL2; TDRD19A; dJ976O13.2
Synonyms
MTF2; MTF2 cDNA Clone; MTF2 cdna clone
Sequence
atgagagactctacaggggcaggtaattcactggtccacaagcggtctcctttacgtcgaaaccaaaagaccccaacatccttgaccaagctgtctttacaggatggacataaagccaaaaagccagcatgtaaatttgaagagggtcaggatgtcctagctagatggtcagatggcttgttttatcttggcactatcaaaaagataaacatattgaaacagagctgcttcatcatatttgaagacagttctaaatcctgggttctctggaaggacattcaaacaggagccactggaagtggggaaatggtctgtacaatatgtcaagaagagtattcagaagctcccaatgaaatggttatatgtgacaagtgtggccaaggatatcatcagttgtgtcacacacctcatattgattccagtgtgattgattcagatgaaaaatggctctgtcggcagtgtgtttttgcaacaacaacaaagaggggtggtgcacttaagaaaggaccaaatgccaaagcattgcaagtcatgaagcagacattaccctatagtgtggcagaccttgaatgggatgcaggtcataaaaccaatgtccagcagtgttactgctattgtggaggccctggagactggtatttgaagatgctacagtgctgcaaatgtaagcagtggtttcatgaggcttgtgtgcaatgccttcaaaagccaatgctatttggagacagattttatacgtttatatgctctgtctgcagttctggaccagaatacctcaaacgtctaccattacagtgggtagatatagcacacctatgcctttacaacctaagtgttattcataagaagaaatactttgattctgaacttgagcttatgacatacattaatgaaaactgggatagattgcaccctggagagctggcagacacaccaaaatctgaaagatatgagcatgttctggaggcattaaatgattacaagaccatggaagtaagcaatggcatagaaaaaaaaggaaagaaaaaatctgtaggtcgtccacctggcccatatacaagaaaaatgattcaaaaaactgctgagccacttttggataaggaatcaatttcagagaatcctactttggatttaccttgttctatagggagaactgagggaactgcacattcatccaatacctcagatgtggatttcacgggtgcttccagtgcaaaagaaactacctcgtctagcatttccaggcattatggattatctgactccagaaaaagaacgcgtacaggaagatcttggcctgctgcaataccacatttgcggagaagaagaggtcgtcttccaagaagagcactccagactcagaactcagaaattgtaaaagatgatgaaggcaaagaagattatcagtttgatgaactcaacacagagattctgaataacttagcagatcaggagttacaactcaatcatctaaagaactccattaccagttattttggtgctgcaggtagaatagcatgtggcgaaaaataccgagttttggcacgtcgggtgacacttgatggaaaggtgcagtatcttgtggaatgggaaggagcaactgcatcctga
Sequence Length
1611
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
60,665 Da
NCBI Official Full Name
Homo sapiens metal response element binding transcription factor 2, mRNA
NCBI Official Synonym Full Names
metal response element binding transcription factor 2
NCBI Official Symbol
MTF2
NCBI Official Synonym Symbols
M96; PCL2; TDRD19A; dJ976O13.2
NCBI Protein Information
metal-response element-binding transcription factor 2
UniProt Protein Name
Metal-response element-binding transcription factor 2
Protein Family
UniProt Gene Name
MTF2
UniProt Synonym Gene Names
PCL2; hPCl2
UniProt Entry Name
MTF2_HUMAN
Uniprot Description
MTF2: Binds to the metal-regulating-element (MRE) of metallothionein-1A gene promoter. Binding is zinc-dependent. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: DNA-binding
Chromosomal Location of Human Ortholog: 1p22.1
Cellular Component: cytoplasm; ESC/E(Z) complex; nucleoplasm; nucleus
Molecular Function: methylated histone residue binding
Biological Process: negative regulation of gene expression, epigenetic; negative regulation of transcription from RNA polymerase II promoter; positive regulation of transcription from RNA polymerase II promoter; segment specification; stem cell differentiation; stem cell maintenance
Research Articles on MTF2
Similar Products
Product Notes
The MTF2 mtf2 (Catalog #AAA1269759) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagagact ctacaggggc aggtaattca ctggtccaca agcggtctcc tttacgtcga aaccaaaaga ccccaacatc cttgaccaag ctgtctttac aggatggaca taaagccaaa aagccagcat gtaaatttga agagggtcag gatgtcctag ctagatggtc agatggcttg ttttatcttg gcactatcaa aaagataaac atattgaaac agagctgctt catcatattt gaagacagtt ctaaatcctg ggttctctgg aaggacattc aaacaggagc cactggaagt ggggaaatgg tctgtacaat atgtcaagaa gagtattcag aagctcccaa tgaaatggtt atatgtgaca agtgtggcca aggatatcat cagttgtgtc acacacctca tattgattcc agtgtgattg attcagatga aaaatggctc tgtcggcagt gtgtttttgc aacaacaaca aagaggggtg gtgcacttaa gaaaggacca aatgccaaag cattgcaagt catgaagcag acattaccct atagtgtggc agaccttgaa tgggatgcag gtcataaaac caatgtccag cagtgttact gctattgtgg aggccctgga gactggtatt tgaagatgct acagtgctgc aaatgtaagc agtggtttca tgaggcttgt gtgcaatgcc ttcaaaagcc aatgctattt ggagacagat tttatacgtt tatatgctct gtctgcagtt ctggaccaga atacctcaaa cgtctaccat tacagtgggt agatatagca cacctatgcc tttacaacct aagtgttatt cataagaaga aatactttga ttctgaactt gagcttatga catacattaa tgaaaactgg gatagattgc accctggaga gctggcagac acaccaaaat ctgaaagata tgagcatgtt ctggaggcat taaatgatta caagaccatg gaagtaagca atggcataga aaaaaaagga aagaaaaaat ctgtaggtcg tccacctggc ccatatacaa gaaaaatgat tcaaaaaact gctgagccac ttttggataa ggaatcaatt tcagagaatc ctactttgga tttaccttgt tctataggga gaactgaggg aactgcacat tcatccaata cctcagatgt ggatttcacg ggtgcttcca gtgcaaaaga aactacctcg tctagcattt ccaggcatta tggattatct gactccagaa aaagaacgcg tacaggaaga tcttggcctg ctgcaatacc acatttgcgg agaagaagag gtcgtcttcc aagaagagca ctccagactc agaactcaga aattgtaaaa gatgatgaag gcaaagaaga ttatcagttt gatgaactca acacagagat tctgaataac ttagcagatc aggagttaca actcaatcat ctaaagaact ccattaccag ttattttggt gctgcaggta gaatagcatg tggcgaaaaa taccgagttt tggcacgtcg ggtgacactt gatggaaagg tgcagtatct tgtggaatgg gaaggagcaa ctgcatcctg a. It is sometimes possible for the material contained within the vial of "MTF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
