PAK1IP1 cdna clone
PAK1IP1 cDNA Clone
Gene Names
PAK1IP1; PIP1; MAK11; WDR84; hPIP1; bA421M1.5
Synonyms
PAK1IP1; PAK1IP1 cDNA Clone; PAK1IP1 cdna clone
Sequence
atggagctggtcgctggttgctacgagcaggtcctctttgggttcgctgtacacccggagcccgaggcttgcggcgaccacgagcaatggactcttgtggctgacttcactcaccatgctcacactgcctccttgtcagcagtagctgtaaatagtcgttttgtggtcactgggagcaaagatgaaacaattcacatttatgacatgaaaaagaagattgagcatggggctctagtgcatcacagtggtacaataacttgcctgaaattctatggcaacaggcatttaatcagtggagcggaagatggactcatctgtatctgggatgcaaagaaatgggaatgcctgaagtcaattaaagctcacaaaggacaggtgaccttcctttctattcacccatctggcaagttggccctgtcggttggtacagataaaactttaagaacgtggaatcttgtagaaggaagatcagcattcataaaaaatataaaacaaaatgctcacatagtagaatggtccccaagaggagagcagtatgtagttatcatacagaataaaatagacatctatcagcttgacactgcatccattagtggcaccgtcacaaatgaaaagagaatttcctctgttaaatttctttcagagtctgtccttgcagtggctggagatgaagaagttataaggttttttgactgtgattcactagtgtgcctctgcgaatttaaagctcatgaaaacagggtaaaggacatgttcagttttgaaattccagagcatcatgttattgtttcagcatcgagtgatggtttcatcaaaatgtggaagcttgagcaggataagaaagttcccccatctttactctgtgaaataaacactaatgccaggctgacgtgtcttggagtgtggctagacaaagtggcagacatgaaagaaagccttcctccagctgcagagccttctcctgtaagtaaagaacagtccaaaattggcaaaaaggagcctggtgacacagtgcacaaagaagaaaagcggtcaaaacctaacacaaagaaacgcggtttaacaggtgacagtaagaaagcaacaaaagaaagtggcctgatatcaaccaagaagaggaaaatggtagaaatgttggaaaagaagaggaaaaagaagaaaataaaaacaatgcagtga
Sequence Length
1179
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
43,964 Da
NCBI Official Full Name
Homo sapiens PAK1 interacting protein 1, mRNA
NCBI Official Synonym Full Names
PAK1 interacting protein 1
NCBI Official Symbol
PAK1IP1
NCBI Official Synonym Symbols
PIP1; MAK11; WDR84; hPIP1; bA421M1.5
NCBI Protein Information
p21-activated protein kinase-interacting protein 1
UniProt Protein Name
p21-activated protein kinase-interacting protein 1
Protein Family
UniProt Gene Name
PAK1IP1
UniProt Synonym Gene Names
PIP1; WDR84; hPIP1
UniProt Entry Name
PK1IP_HUMAN
Uniprot Description
PAK1IP1: Negatively regulates the PAK1 kinase. PAK1 is a member of the PAK kinase family, which have been shown to play a positive role in the regulation of signaling pathways involving MAPK8 and RELA. PAK1 exists as an inactive homodimer, which is activated by binding of small GTPases such as CDC42 to an N-terminal regulatory domain. PAK1IP1 also binds to the N-terminus of PAK1, and inhibits the specific activation of PAK1 by CDC42.
Protein type: Nucleolus; Inhibitor
Chromosomal Location of Human Ortholog: 6p24.2
Cellular Component: nucleoplasm; plasma membrane
Molecular Function: protein binding
Research Articles on PAK1IP1
Similar Products
Product Notes
The PAK1IP1 pak1ip1 (Catalog #AAA1269747) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagctgg tcgctggttg ctacgagcag gtcctctttg ggttcgctgt acacccggag cccgaggctt gcggcgacca cgagcaatgg actcttgtgg ctgacttcac tcaccatgct cacactgcct ccttgtcagc agtagctgta aatagtcgtt ttgtggtcac tgggagcaaa gatgaaacaa ttcacattta tgacatgaaa aagaagattg agcatggggc tctagtgcat cacagtggta caataacttg cctgaaattc tatggcaaca ggcatttaat cagtggagcg gaagatggac tcatctgtat ctgggatgca aagaaatggg aatgcctgaa gtcaattaaa gctcacaaag gacaggtgac cttcctttct attcacccat ctggcaagtt ggccctgtcg gttggtacag ataaaacttt aagaacgtgg aatcttgtag aaggaagatc agcattcata aaaaatataa aacaaaatgc tcacatagta gaatggtccc caagaggaga gcagtatgta gttatcatac agaataaaat agacatctat cagcttgaca ctgcatccat tagtggcacc gtcacaaatg aaaagagaat ttcctctgtt aaatttcttt cagagtctgt ccttgcagtg gctggagatg aagaagttat aaggtttttt gactgtgatt cactagtgtg cctctgcgaa tttaaagctc atgaaaacag ggtaaaggac atgttcagtt ttgaaattcc agagcatcat gttattgttt cagcatcgag tgatggtttc atcaaaatgt ggaagcttga gcaggataag aaagttcccc catctttact ctgtgaaata aacactaatg ccaggctgac gtgtcttgga gtgtggctag acaaagtggc agacatgaaa gaaagccttc ctccagctgc agagccttct cctgtaagta aagaacagtc caaaattggc aaaaaggagc ctggtgacac agtgcacaaa gaagaaaagc ggtcaaaacc taacacaaag aaacgcggtt taacaggtga cagtaagaaa gcaacaaaag aaagtggcct gatatcaacc aagaagagga aaatggtaga aatgttggaa aagaagagga aaaagaagaa aataaaaaca atgcagtga. It is sometimes possible for the material contained within the vial of "PAK1IP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
