Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RARS2 cdna clone

RARS2 cDNA Clone

Gene Names
RARS2; PCH6; ArgRS; RARSL; DALRD2; PRO1992
Synonyms
RARS2; RARS2 cDNA Clone; RARS2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgtgcggctttcgccgcgctattgcttgccagctttccagagtgttgaatcttccaccagaaaacttgatcacatcaatatctgcagttccaatttcccaaaaagaagaagtagctgattttcagctttctgtggattctttattggaaaaagacaatgaccattcaagaccagatattcaagttcaagccaagagactagcagagaagctaagatgtgatacagtggtgagtgaaatcagtactggtcaaaggactgtaaatttcaaaataaacagagagctcttaacaaagacagtgctacaacaagtaattgaagatggctcaaaatatggattaaaaagtgaacttttctctggacttccccagaagaagattgtggttgaattcagttcacctaatgttgccaaaaaatttcatgttggacatttgcgttctaccatcataggaaattttatagcaaatctcaaagaagctttaggacatcaagtaataagaataaattaccttggcgattggggcatgcagtttggtcttctgggaactggcttccagctgtttggctatgaggaaaaactgcagtccaatcctctacagcatctctttgaagtttatgtacaagttaataaagaagcagcagatgataaaagtgtagcaaaagcagcacaggagttcttccaacgattggaactgggcgatgtgcaagcactttcactgtggcaaaaatttcgggacttgagcattgaagagtacattcgggtttacaagcgtctgggagtatattttgatgaatattcaggagaatcattttatcgtgaaaaatctcaagaggtcttaaagttgctggagagtaaaggactcctactgagaacaataaaaggaacggctgtagtagatctctctgggaatggcgacccctcctcaatttgtactgtaatgcgaagtgatgggacttctctctatgcaaccagagatcttgcagctgctatagatcgaatggacaagtataattttgatacaatgatatatgtgacagataaaggacaaaaaaagcattttcagcaagtattccaaatgctgaagatcatgggatatgactgggcagaaaggtgccagcacgtgccctttggagtagtacagggaatgaagactcgaagaggagatgtcactttcctggaagatgttttaaatgagattcaattaaggatgctacagaacatggcttcaattaagacaactaaagaactcaagaacccacaagagactgcagagagggtcgggctcgcagcactcattattcaggacttcaaaggtttactcttatctgactacaagttcagctgggatcgtgttttccagagtcgcggggacacaggagtcttcctacagtacacacacgcccgcctccacagtttggaagagacttttggatgtgggtacctgaatgacttcaacactgcttgtttacaagagccacagtctgtttcaattcttcagcatcttctcaggttcgacgaggtgctttataaatcatctcaggactttcaacccaggcatatcgtcagttaccttctaactttaagtcatcttgcagctgtggcacacaaaacactacaaataaaagatagtcctcctgaagtggctggggccagacttcatcttttcaaagctgtccgttctgtcctagccaatggaatgaaacttcttggaataacacctgtatgtaggatgtaa
Sequence Length
1737
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
65,505 Da
NCBI Official Full Name
Homo sapiens arginyl-tRNA synthetase 2, mitochondrial, mRNA
NCBI Official Synonym Full Names
arginyl-tRNA synthetase 2, mitochondrial
NCBI Official Symbol
RARS2
NCBI Official Synonym Symbols
PCH6; ArgRS; RARSL; DALRD2; PRO1992
NCBI Protein Information
probable arginine--tRNA ligase, mitochondrial
UniProt Protein Name
Probable arginine--tRNA ligase, mitochondrial
UniProt Gene Name
RARS2
UniProt Synonym Gene Names
RARSL; ArgRS
UniProt Entry Name
SYRM_HUMAN

NCBI Description

This nuclear gene encodes a protein that localizes to the mitochondria, where it catalyzes the transfer of L-arginine to its cognate tRNA, an important step in translation of mitochondrially-encoded proteins. Defects in this gene are a cause of pontocerebellar hypoplasia type 6 (PCH6). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]

Uniprot Description

RARS2: Defects in RARS2 are the cause of pontocerebellar hypoplasia type 6 (PCH6); also known as fatal infantile encephalopathy with mitochondrial respiratory chain defects. Pontocerebellar hypoplasia (PCH) is a heterogeneous group of disorders characterized by an abnormally small cerebellum and brainstem. Belongs to the class-I aminoacyl-tRNA synthetase family.

Protein type: EC 6.1.1.19; Mitochondrial; Ligase

Chromosomal Location of Human Ortholog: 6q16.1

Cellular Component: mitochondrial matrix; mitochondrion

Molecular Function: arginine-tRNA ligase activity

Biological Process: arginyl-tRNA aminoacylation; mitochondrial translation; tRNA aminoacylation for protein translation

Disease: Pontocerebellar Hypoplasia, Type 6

Research Articles on RARS2

Similar Products

Product Notes

The RARS2 rars2 (Catalog #AAA1269729) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtgcg gctttcgccg cgctattgct tgccagcttt ccagagtgtt gaatcttcca ccagaaaact tgatcacatc aatatctgca gttccaattt cccaaaaaga agaagtagct gattttcagc tttctgtgga ttctttattg gaaaaagaca atgaccattc aagaccagat attcaagttc aagccaagag actagcagag aagctaagat gtgatacagt ggtgagtgaa atcagtactg gtcaaaggac tgtaaatttc aaaataaaca gagagctctt aacaaagaca gtgctacaac aagtaattga agatggctca aaatatggat taaaaagtga acttttctct ggacttcccc agaagaagat tgtggttgaa ttcagttcac ctaatgttgc caaaaaattt catgttggac atttgcgttc taccatcata ggaaatttta tagcaaatct caaagaagct ttaggacatc aagtaataag aataaattac cttggcgatt ggggcatgca gtttggtctt ctgggaactg gcttccagct gtttggctat gaggaaaaac tgcagtccaa tcctctacag catctctttg aagtttatgt acaagttaat aaagaagcag cagatgataa aagtgtagca aaagcagcac aggagttctt ccaacgattg gaactgggcg atgtgcaagc actttcactg tggcaaaaat ttcgggactt gagcattgaa gagtacattc gggtttacaa gcgtctggga gtatattttg atgaatattc aggagaatca ttttatcgtg aaaaatctca agaggtctta aagttgctgg agagtaaagg actcctactg agaacaataa aaggaacggc tgtagtagat ctctctggga atggcgaccc ctcctcaatt tgtactgtaa tgcgaagtga tgggacttct ctctatgcaa ccagagatct tgcagctgct atagatcgaa tggacaagta taattttgat acaatgatat atgtgacaga taaaggacaa aaaaagcatt ttcagcaagt attccaaatg ctgaagatca tgggatatga ctgggcagaa aggtgccagc acgtgccctt tggagtagta cagggaatga agactcgaag aggagatgtc actttcctgg aagatgtttt aaatgagatt caattaagga tgctacagaa catggcttca attaagacaa ctaaagaact caagaaccca caagagactg cagagagggt cgggctcgca gcactcatta ttcaggactt caaaggttta ctcttatctg actacaagtt cagctgggat cgtgttttcc agagtcgcgg ggacacagga gtcttcctac agtacacaca cgcccgcctc cacagtttgg aagagacttt tggatgtggg tacctgaatg acttcaacac tgcttgttta caagagccac agtctgtttc aattcttcag catcttctca ggttcgacga ggtgctttat aaatcatctc aggactttca acccaggcat atcgtcagtt accttctaac tttaagtcat cttgcagctg tggcacacaa aacactacaa ataaaagata gtcctcctga agtggctggg gccagacttc atcttttcaa agctgtccgt tctgtcctag ccaatggaat gaaacttctt ggaataacac ctgtatgtag gatgtaa. It is sometimes possible for the material contained within the vial of "RARS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.